Incidental Mutation 'R4244:Kcnv1'
ID320360
Institutional Source Beutler Lab
Gene Symbol Kcnv1
Ensembl Gene ENSMUSG00000022342
Gene Namepotassium channel, subfamily V, member 1
Synonyms2700023A03Rik
MMRRC Submission 041060-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4244 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location45106284-45114920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45114444 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 66 (T66M)
Ref Sequence ENSEMBL: ENSMUSP00000022967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022967]
Predicted Effect probably damaging
Transcript: ENSMUST00000022967
AA Change: T66M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022967
Gene: ENSMUSG00000022342
AA Change: T66M

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
BTB 42 160 1.17e-12 SMART
Pfam:Ion_trans 212 440 8.9e-45 PFAM
Pfam:Ion_trans_2 350 436 3.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228536
Meta Mutation Damage Score 0.532 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This protein is essentially present in the brain, and its role might be to inhibit the function of a particular class of outward rectifier potassium channel types. [provided by RefSeq, Jul 2008]
PHENOTYPE: At weaning, homozygous mutant mice exhibit tetany, tremors and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T C 14: 8,482,521 T551A probably benign Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
Ap1g1 G A 8: 109,833,490 S281N probably benign Het
Arfgef3 C A 10: 18,630,420 G878V probably damaging Het
Ccdc137 T C 11: 120,462,018 F196S probably damaging Het
Ccdc18 C T 5: 108,148,972 Q214* probably null Het
Ccrl2 T C 9: 111,055,354 I359V probably benign Het
Cdh20 C T 1: 104,942,143 T196I probably damaging Het
Col6a3 G T 1: 90,786,639 T1683K unknown Het
Copa A G 1: 172,110,718 I524V probably benign Het
Cyld A T 8: 88,730,755 R536* probably null Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dock5 A G 14: 67,774,582 F1348L probably benign Het
Efcab3 A T 11: 105,111,803 K5664I probably damaging Het
Gm5174 C A 10: 86,656,280 noncoding transcript Het
Gm9892 A T 8: 52,196,400 noncoding transcript Het
Grm4 A G 17: 27,502,735 I144T probably damaging Het
Krt28 G T 11: 99,374,550 S97Y probably damaging Het
Map3k6 T C 4: 133,251,947 Y1204H possibly damaging Het
Mfsd2b G T 12: 4,874,356 probably benign Het
Nav3 T C 10: 109,769,296 D972G probably damaging Het
Olfr1167 T C 2: 88,149,288 T244A probably benign Het
Olfr131 C T 17: 38,082,430 V183I probably benign Het
Olfr319 T G 11: 58,702,451 L250R probably damaging Het
Prex1 G A 2: 166,570,336 R392W probably damaging Het
Ptpn5 C T 7: 47,091,548 W38* probably null Het
Rab3gap1 T C 1: 127,937,567 probably null Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Scn7a T C 2: 66,742,001 I209V probably benign Het
Sh3d21 C T 4: 126,150,718 probably benign Het
Slc27a1 A G 8: 71,584,973 T535A probably benign Het
Slc5a5 A G 8: 70,890,286 V210A probably benign Het
Snx25 A G 8: 46,105,254 C239R probably damaging Het
Sp5 T C 2: 70,477,038 F356L probably damaging Het
Spaca9 T C 2: 28,692,986 I141V probably benign Het
Tbcd T A 11: 121,594,281 L763H probably damaging Het
Thnsl1 A G 2: 21,212,248 E271G probably benign Het
Vmn1r79 T A 7: 12,177,044 C284* probably null Het
Vwa5a T C 9: 38,737,816 probably benign Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zscan29 C T 2: 121,164,794 probably null Het
Other mutations in Kcnv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Kcnv1 APN 15 45113228 missense probably benign 0.00
IGL02227:Kcnv1 APN 15 45114274 missense probably damaging 1.00
IGL02472:Kcnv1 APN 15 45109123 nonsense probably null
IGL03239:Kcnv1 APN 15 45109490 splice site probably benign
R0079:Kcnv1 UTSW 15 45113333 missense probably damaging 1.00
R0534:Kcnv1 UTSW 15 45109249 missense probably damaging 0.98
R0627:Kcnv1 UTSW 15 45112881 splice site probably benign
R1614:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R1615:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R2942:Kcnv1 UTSW 15 45109185 missense probably damaging 1.00
R4290:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4291:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4293:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4294:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4295:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4335:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4342:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4345:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4354:Kcnv1 UTSW 15 45114444 missense probably damaging 1.00
R4934:Kcnv1 UTSW 15 45109248 missense probably damaging 1.00
R5240:Kcnv1 UTSW 15 45113244 missense probably damaging 1.00
R5295:Kcnv1 UTSW 15 45114591 missense unknown
R5631:Kcnv1 UTSW 15 45109357 missense probably damaging 1.00
R5669:Kcnv1 UTSW 15 45114252 missense possibly damaging 0.71
R5762:Kcnv1 UTSW 15 45109122 missense probably damaging 0.99
R5776:Kcnv1 UTSW 15 45114567 missense unknown
R5787:Kcnv1 UTSW 15 45114330 missense probably damaging 1.00
R5980:Kcnv1 UTSW 15 45109414 missense probably damaging 0.99
R6819:Kcnv1 UTSW 15 45109117 missense probably damaging 0.99
R6851:Kcnv1 UTSW 15 45109198 missense probably damaging 1.00
R6997:Kcnv1 UTSW 15 45114601 missense unknown
X0026:Kcnv1 UTSW 15 45109467 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CAGTGCGATAGTAGTGCAGGAC -3'
(R):5'- AACTTCCCAGTGCCTTCAG -3'

Sequencing Primer
(F):5'- TGCGATAGTAGTGCAGGACATAAC -3'
(R):5'- TCAGGATGGATCTGTCACCC -3'
Posted On2015-06-12