Incidental Mutation 'R4245:Phactr3'
ID320371
Institutional Source Beutler Lab
Gene Symbol Phactr3
Ensembl Gene ENSMUSG00000027525
Gene Namephosphatase and actin regulator 3
Synonyms4930415A02Rik, 1500003N10Rik, scapinin
MMRRC Submission 041061-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R4245 (G1)
Quality Score175
Status Validated
Chromosome2
Chromosomal Location178118975-178338492 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 178283189 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103065] [ENSMUST00000103066] [ENSMUST00000108915] [ENSMUST00000108916] [ENSMUST00000108917]
Predicted Effect probably null
Transcript: ENSMUST00000103065
SMART Domains Protein: ENSMUSP00000099354
Gene: ENSMUSG00000027525

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
RPEL 52 77 2.08e0 SMART
low complexity region 187 206 N/A INTRINSIC
RPEL 360 385 5.1e-4 SMART
low complexity region 387 397 N/A INTRINSIC
RPEL 398 423 3.24e-6 SMART
RPEL 436 461 9.82e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103066
SMART Domains Protein: ENSMUSP00000099355
Gene: ENSMUSG00000027525

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
RPEL 92 117 2.08e0 SMART
low complexity region 227 246 N/A INTRINSIC
RPEL 400 425 5.1e-4 SMART
low complexity region 427 437 N/A INTRINSIC
RPEL 438 463 3.24e-6 SMART
RPEL 476 501 9.82e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108915
SMART Domains Protein: ENSMUSP00000104543
Gene: ENSMUSG00000027525

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
RPEL 93 118 2.08e0 SMART
low complexity region 228 247 N/A INTRINSIC
RPEL 401 426 5.1e-4 SMART
low complexity region 428 438 N/A INTRINSIC
RPEL 439 464 3.24e-6 SMART
RPEL 477 502 9.82e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108916
SMART Domains Protein: ENSMUSP00000104544
Gene: ENSMUSG00000027525

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
RPEL 88 113 2.08e0 SMART
low complexity region 223 242 N/A INTRINSIC
RPEL 396 421 5.1e-4 SMART
low complexity region 423 433 N/A INTRINSIC
RPEL 434 459 3.24e-6 SMART
RPEL 472 497 9.82e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108917
SMART Domains Protein: ENSMUSP00000104545
Gene: ENSMUSG00000027525

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
RPEL 88 113 2.08e0 SMART
low complexity region 223 242 N/A INTRINSIC
RPEL 396 421 5.1e-4 SMART
low complexity region 423 433 N/A INTRINSIC
RPEL 436 458 2.74e-4 SMART
RPEL 471 496 9.82e-6 SMART
Meta Mutation Damage Score 0.6484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatase and actin regulator protein family. The encoded protein is associated with the nuclear scaffold in proliferating cells, and binds to actin and the catalytic subunit of protein phosphatase-1, suggesting that it functions as a regulatory subunit of protein phosphatase-1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik T A 3: 59,825,782 noncoding transcript Het
4931408C20Rik T C 1: 26,682,080 N1340D probably benign Het
Acacb A T 5: 114,230,784 T1688S probably damaging Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
C8a A G 4: 104,876,346 V4A probably benign Het
Ccdc171 A G 4: 83,554,808 D158G probably damaging Het
Ccdc184 T A 15: 98,168,869 probably null Het
Cdc23 T C 18: 34,637,047 probably benign Het
Dnah5 A G 15: 28,219,189 N51S probably benign Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dusp27 T C 1: 166,101,116 E309G probably damaging Het
Eepd1 T C 9: 25,594,624 I460T probably benign Het
Fen1 T A 19: 10,200,367 I238F probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm5493 A G 17: 22,747,226 E28G probably benign Het
Jakmip2 A G 18: 43,577,436 V234A probably benign Het
Map3k6 T C 4: 133,251,947 Y1204H possibly damaging Het
Mpeg1 C A 19: 12,462,908 Q577K probably damaging Het
Mthfd1 T C 12: 76,301,273 S564P probably damaging Het
Mtmr11 T A 3: 96,168,077 C358S probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Myo18b G A 5: 112,692,395 H2511Y possibly damaging Het
Ndufs6 A T 13: 73,320,393 D62E probably damaging Het
Olfr18 T C 9: 20,314,333 I196V possibly damaging Het
Olfr313 T C 11: 58,817,778 Y257H probably damaging Het
Pcdhga1 T A 18: 37,663,552 D536E probably damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk2 C T 15: 73,231,976 G749D probably benign Het
Rab3il1 A T 19: 10,030,154 D222V probably damaging Het
Radil T C 5: 142,543,791 D50G probably damaging Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Scn7a T C 2: 66,742,001 I209V probably benign Het
Sf3a1 C T 11: 4,167,774 R179C probably damaging Het
Tg T C 15: 66,696,469 V1335A possibly damaging Het
Thnsl1 A G 2: 21,212,248 E271G probably benign Het
Vill T A 9: 119,071,291 probably benign Het
Vmn2r79 A G 7: 87,002,416 D341G possibly damaging Het
Wdr59 T C 8: 111,490,364 N272D possibly damaging Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zfp985 A G 4: 147,582,939 K88R probably damaging Het
Zscan29 C T 2: 121,164,794 probably null Het
Other mutations in Phactr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Phactr3 APN 2 178279062 missense probably benign 0.00
IGL01432:Phactr3 APN 2 178283100 missense probably benign 0.05
IGL01580:Phactr3 APN 2 178269504 splice site probably benign
IGL02688:Phactr3 APN 2 178278999 missense probably damaging 0.96
IGL02985:Phactr3 APN 2 178175457 missense probably benign
PIT4151001:Phactr3 UTSW 2 178334068 missense probably damaging 1.00
R1854:Phactr3 UTSW 2 178283147 missense probably damaging 1.00
R2132:Phactr3 UTSW 2 178283966 missense probably benign 0.14
R3110:Phactr3 UTSW 2 178279017 missense possibly damaging 0.85
R3112:Phactr3 UTSW 2 178279017 missense possibly damaging 0.85
R3122:Phactr3 UTSW 2 178331618 missense probably damaging 1.00
R4193:Phactr3 UTSW 2 178283152 missense probably damaging 0.98
R4194:Phactr3 UTSW 2 178283109 missense possibly damaging 0.80
R4243:Phactr3 UTSW 2 178283189 splice site probably null
R4397:Phactr3 UTSW 2 178175406 intron probably benign
R4433:Phactr3 UTSW 2 178283132 missense probably damaging 1.00
R4581:Phactr3 UTSW 2 178283172 missense probably damaging 1.00
R4772:Phactr3 UTSW 2 178283936 missense probably damaging 1.00
R4830:Phactr3 UTSW 2 178284018 missense probably damaging 0.98
R5045:Phactr3 UTSW 2 178331619 missense probably damaging 1.00
R5442:Phactr3 UTSW 2 178142461 missense probably benign 0.38
R5461:Phactr3 UTSW 2 178278901 missense probably benign
R5816:Phactr3 UTSW 2 178302793 missense probably damaging 1.00
R6276:Phactr3 UTSW 2 178279019 missense probably damaging 0.99
R6668:Phactr3 UTSW 2 178332864 missense probably damaging 1.00
R7144:Phactr3 UTSW 2 178302736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCTGCGCTCTTCCAAG -3'
(R):5'- TCGTGGGGATTTCAGAATCG -3'

Sequencing Primer
(F):5'- TCTTCCAAGGCCCCAGCATG -3'
(R):5'- TCGTGGGGATTTCAGAATCGTAAAC -3'
Posted On2015-06-12