Incidental Mutation 'R4245:4930449A18Rik'
List |< first << previous [record 62 of 1920] next >> last >|
ID320372
Institutional Source Beutler Lab
Gene Symbol 4930449A18Rik
Ensembl Gene ENSMUSG00000074589
Gene NameRIKEN cDNA 4930449A18 gene
Synonyms
MMRRC Submission 041061-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R4245 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59777809-59846817 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 59825782 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000094228
SMART Domains Protein: ENSMUSP00000091781
Gene: ENSMUSG00000074589

DomainStartEndE-ValueType
SCOP:d1qfma2 104 157 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192453
Meta Mutation Damage Score 0.286 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,682,080 N1340D probably benign Het
Acacb A T 5: 114,230,784 T1688S probably damaging Het
Actr1b T C 1: 36,701,830 Y171C possibly damaging Het
C8a A G 4: 104,876,346 V4A probably benign Het
Ccdc171 A G 4: 83,554,808 D158G probably damaging Het
Ccdc184 T A 15: 98,168,869 probably null Het
Cdc23 T C 18: 34,637,047 probably benign Het
Dnah5 A G 15: 28,219,189 N51S probably benign Het
Dock10 T A 1: 80,566,755 E905V probably benign Het
Dusp27 T C 1: 166,101,116 E309G probably damaging Het
Eepd1 T C 9: 25,594,624 I460T probably benign Het
Fen1 T A 19: 10,200,367 I238F probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gm5493 A G 17: 22,747,226 E28G probably benign Het
Jakmip2 A G 18: 43,577,436 V234A probably benign Het
Map3k6 T C 4: 133,251,947 Y1204H possibly damaging Het
Mpeg1 C A 19: 12,462,908 Q577K probably damaging Het
Mthfd1 T C 12: 76,301,273 S564P probably damaging Het
Mtmr11 T A 3: 96,168,077 C358S probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Myo18b G A 5: 112,692,395 H2511Y possibly damaging Het
Ndufs6 A T 13: 73,320,393 D62E probably damaging Het
Olfr18 T C 9: 20,314,333 I196V possibly damaging Het
Olfr313 T C 11: 58,817,778 Y257H probably damaging Het
Pcdhga1 T A 18: 37,663,552 D536E probably damaging Het
Phactr3 G A 2: 178,283,189 probably null Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk2 C T 15: 73,231,976 G749D probably benign Het
Rab3il1 A T 19: 10,030,154 D222V probably damaging Het
Radil T C 5: 142,543,791 D50G probably damaging Het
Rfx7 A G 9: 72,591,769 T72A possibly damaging Het
Scn7a T C 2: 66,742,001 I209V probably benign Het
Sf3a1 C T 11: 4,167,774 R179C probably damaging Het
Tg T C 15: 66,696,469 V1335A possibly damaging Het
Thnsl1 A G 2: 21,212,248 E271G probably benign Het
Vill T A 9: 119,071,291 probably benign Het
Vmn2r79 A G 7: 87,002,416 D341G possibly damaging Het
Wdr59 T C 8: 111,490,364 N272D possibly damaging Het
Zar1 T C 5: 72,580,393 E121G possibly damaging Het
Zfp985 A G 4: 147,582,939 K88R probably damaging Het
Zscan29 C T 2: 121,164,794 probably null Het
Other mutations in 4930449A18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02536:4930449A18Rik APN 3 59778244 exon noncoding transcript
R4243:4930449A18Rik UTSW 3 59825782 exon noncoding transcript
R4368:4930449A18Rik UTSW 3 59846778 exon noncoding transcript
R4466:4930449A18Rik UTSW 3 59838466 exon noncoding transcript
R4755:4930449A18Rik UTSW 3 59825859 exon noncoding transcript
R4842:4930449A18Rik UTSW 3 59841732 exon noncoding transcript
R5214:4930449A18Rik UTSW 3 59825884 splice site noncoding transcript
R5436:4930449A18Rik UTSW 3 59846693 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AGTCAACTGCTGCCATAATGTATG -3'
(R):5'- GTAACAAGGCCTCCCTGATC -3'

Sequencing Primer
(F):5'- GCTGCCATAATGTATGATATTGATCC -3'
(R):5'- CTCCCTGATCCCCAGAAAATG -3'
Posted On2015-06-12