Incidental Mutation 'R4246:Dock6'
ID320428
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 041062-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.425) question?
Stock #R4246 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 21839490 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000034728] [ENSMUST00000058777] [ENSMUST00000217336]
Predicted Effect probably null
Transcript: ENSMUST00000034728
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000034728
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058777
SMART Domains Protein: ENSMUSP00000058951
Gene: ENSMUSG00000047822

DomainStartEndE-ValueType
low complexity region 171 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213775
Predicted Effect probably null
Transcript: ENSMUST00000217336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217515
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Ak1 A G 2: 32,633,372 T151A possibly damaging Het
Asxl3 A G 18: 22,525,500 D2189G probably damaging Het
Ccdc91 C T 6: 147,592,148 A346V unknown Het
Dnah6 C T 6: 73,129,448 E1769K probably benign Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Glyatl3 T A 17: 40,910,098 D126V probably benign Het
Gm15922 C T 7: 3,737,349 G291E probably damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Igkv8-21 T A 6: 70,315,452 M1L possibly damaging Het
Itih4 C A 14: 30,891,402 H261N probably damaging Het
Jpt1 T C 11: 115,514,293 probably benign Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Klhl32 A C 4: 24,800,822 S3A possibly damaging Het
Kmt2d C T 15: 98,840,089 probably benign Het
Lamtor5 T C 3: 107,279,038 V41A probably benign Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrfn1 G T 7: 28,459,942 V429L probably benign Het
Mapkbp1 T A 2: 120,013,027 I252N probably damaging Het
Nelfa A G 5: 33,899,029 F464S probably damaging Het
Nipbl G A 15: 8,332,432 L1454F probably damaging Het
Nr4a3 C T 4: 48,083,125 P553S possibly damaging Het
Nrg3 G A 14: 39,472,241 T187I possibly damaging Het
Olfr1030 T A 2: 85,984,280 C147S possibly damaging Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Pcdha8 A G 18: 36,992,897 E144G probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ppp1r3a T A 6: 14,719,781 E378V probably damaging Het
Psd2 T C 18: 36,006,119 L540P probably damaging Het
Rnf14 T A 18: 38,301,648 probably null Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3d19 G A 3: 86,126,688 V783I probably benign Het
Snca T C 6: 60,733,165 E110G possibly damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trhr A T 15: 44,233,460 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tuft1 C A 3: 94,614,801 M319I probably benign Het
Vill C A 9: 119,060,393 N132K probably damaging Het
Wars2 T A 3: 99,216,588 V255E probably damaging Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2341:Dock6 UTSW 9 21839486 splice site probably benign
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 intron probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GCTGAAAGTTCCCAAGATAGATG -3'
(R):5'- ACTTGGCCAACATCGTGAGC -3'

Sequencing Primer
(F):5'- CCCAGGAGGAAAAGAAATCTGTTTTC -3'
(R):5'- AACATCGTGAGCAGGCC -3'
Posted On2015-06-12