Incidental Mutation 'R4246:Gnal'
ID320446
Institutional Source Beutler Lab
Gene Symbol Gnal
Ensembl Gene ENSMUSG00000024524
Gene Nameguanine nucleotide binding protein, alpha stimulating, olfactory type
SynonymsGna10, 9630020G10Rik, Galphaolf, 2610011C15Rik, Golf, G alpha 10
MMRRC Submission 041062-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R4246 (G1)
Quality Score122
Status Not validated
Chromosome18
Chromosomal Location67088336-67226792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 67088583 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 19 (P19R)
Ref Sequence ENSEMBL: ENSMUSP00000025402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025402]
Predicted Effect unknown
Transcript: ENSMUST00000025402
AA Change: P19R
SMART Domains Protein: ENSMUSP00000025402
Gene: ENSMUSG00000024524
AA Change: P19R

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
G_alpha 89 447 1.18e-172 SMART
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a stimulatory G protein alpha subunit which mediates odorant signaling in the olfactory epithelium. This protein couples dopamine type 1 receptors and adenosine A2A receptors and is widely expressed in the central nervous system. Mutations in this gene have been associated with dystonia 25 and this gene is located in a susceptibility region for bipolar disorder and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous for a targeted mutation fail to feed, and ~75% die within 2 days after birth. Rare survivors reach sexual maturity and mate but are hyperactive and anosmic, exhibitng severely reduced odor-evoked electrophysical responses and significantly perturbed maternal behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Ak1 A G 2: 32,633,372 T151A possibly damaging Het
Asxl3 A G 18: 22,525,500 D2189G probably damaging Het
Ccdc91 C T 6: 147,592,148 A346V unknown Het
Dnah6 C T 6: 73,129,448 E1769K probably benign Het
Dock6 A T 9: 21,839,490 probably null Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Glyatl3 T A 17: 40,910,098 D126V probably benign Het
Gm15922 C T 7: 3,737,349 G291E probably damaging Het
Igkv8-21 T A 6: 70,315,452 M1L possibly damaging Het
Itih4 C A 14: 30,891,402 H261N probably damaging Het
Jpt1 T C 11: 115,514,293 probably benign Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Klhl32 A C 4: 24,800,822 S3A possibly damaging Het
Kmt2d C T 15: 98,840,089 probably benign Het
Lamtor5 T C 3: 107,279,038 V41A probably benign Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrfn1 G T 7: 28,459,942 V429L probably benign Het
Mapkbp1 T A 2: 120,013,027 I252N probably damaging Het
Nelfa A G 5: 33,899,029 F464S probably damaging Het
Nipbl G A 15: 8,332,432 L1454F probably damaging Het
Nr4a3 C T 4: 48,083,125 P553S possibly damaging Het
Nrg3 G A 14: 39,472,241 T187I possibly damaging Het
Olfr1030 T A 2: 85,984,280 C147S possibly damaging Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Pcdha8 A G 18: 36,992,897 E144G probably damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ppp1r3a T A 6: 14,719,781 E378V probably damaging Het
Psd2 T C 18: 36,006,119 L540P probably damaging Het
Rnf14 T A 18: 38,301,648 probably null Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3d19 G A 3: 86,126,688 V783I probably benign Het
Snca T C 6: 60,733,165 E110G possibly damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trhr A T 15: 44,233,460 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Tuft1 C A 3: 94,614,801 M319I probably benign Het
Vill C A 9: 119,060,393 N132K probably damaging Het
Wars2 T A 3: 99,216,588 V255E probably damaging Het
Zcchc14 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG 8: 121,604,292 probably benign Het
Other mutations in Gnal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Gnal APN 18 67134289 splice site probably null
IGL01290:Gnal APN 18 67211098 missense probably damaging 1.00
IGL02097:Gnal APN 18 67217208 splice site probably benign
IGL02519:Gnal APN 18 67088765 missense unknown
IGL02691:Gnal APN 18 67222675 missense probably damaging 1.00
R0455:Gnal UTSW 18 67135649 splice site probably benign
R0506:Gnal UTSW 18 67088673 missense unknown
R2107:Gnal UTSW 18 67213578 missense probably damaging 1.00
R3937:Gnal UTSW 18 67135370 splice site probably null
R4247:Gnal UTSW 18 67088583 missense unknown
R4299:Gnal UTSW 18 67088583 missense unknown
R4343:Gnal UTSW 18 67135588 missense probably benign 0.29
R5309:Gnal UTSW 18 67213107 missense possibly damaging 0.49
R5579:Gnal UTSW 18 67088771 missense unknown
R5939:Gnal UTSW 18 67191385 missense probably damaging 0.98
R6277:Gnal UTSW 18 67213072 missense probably damaging 1.00
R7031:Gnal UTSW 18 67222588 missense probably damaging 0.99
R7142:Gnal UTSW 18 67218528 missense probably damaging 1.00
R7343:Gnal UTSW 18 67135525 missense probably benign 0.03
R7366:Gnal UTSW 18 67211071 missense possibly damaging 0.58
Z1088:Gnal UTSW 18 67191403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGATGCACAATGGCCCTTC -3'
(R):5'- ACATTCTCCAAGGCAGGGTC -3'

Sequencing Primer
(F):5'- CCTTCGGGGCAGTGAGG -3'
(R):5'- GTGCAGACCTACCCAGCAG -3'
Posted On2015-06-12