Incidental Mutation 'R4247:Dclre1b'
ID320451
Institutional Source Beutler Lab
Gene Symbol Dclre1b
Ensembl Gene ENSMUSG00000027845
Gene NameDNA cross-link repair 1B
SynonymsSNMIB, Apollo, mSNM1B
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4247 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103800605-103809444 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 103804084 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029435] [ENSMUST00000063502] [ENSMUST00000106832] [ENSMUST00000106834] [ENSMUST00000106834] [ENSMUST00000128716] [ENSMUST00000198752]
Predicted Effect probably null
Transcript: ENSMUST00000029435
SMART Domains Protein: ENSMUSP00000029435
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 301 1e-13 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably null
Transcript: ENSMUST00000063502
SMART Domains Protein: ENSMUSP00000067695
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 49 4e-24 BLAST
Pfam:DRMBL 89 176 7.4e-20 PFAM
PDB:3BUA|H 366 400 8e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000106832
SMART Domains Protein: ENSMUSP00000102445
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106834
SMART Domains Protein: ENSMUSP00000102447
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 302 7.9e-20 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably null
Transcript: ENSMUST00000106834
SMART Domains Protein: ENSMUSP00000102447
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 302 7.9e-20 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128716
SMART Domains Protein: ENSMUSP00000121063
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 63 3e-40 BLAST
PDB:3ZDK|A 1 63 3e-34 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149374
Predicted Effect probably null
Transcript: ENSMUST00000198752
SMART Domains Protein: ENSMUSP00000143067
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 93 2e-64 BLAST
PDB:3ZDK|A 1 97 1e-62 PDB
SCOP:d1a7ta_ 3 93 5e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198835
Meta Mutation Damage Score 0.6648 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA interstrand cross-links prevent strand separation, thereby physically blocking transcription, replication, and segregation of DNA. DCLRE1B is one of several evolutionarily conserved genes involved in repair of interstrand cross-links (Dronkert et al., 2000 [PubMed 10848582]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced embryo size and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Dclre1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Dclre1b APN 3 103803126 missense probably benign
IGL01411:Dclre1b APN 3 103803323 missense probably damaging 1.00
IGL02311:Dclre1b APN 3 103808093 missense probably damaging 1.00
IGL03250:Dclre1b APN 3 103804064 unclassified probably null
IGL03410:Dclre1b APN 3 103808140 missense probably damaging 1.00
IGL03046:Dclre1b UTSW 3 103803281 missense probably benign 0.00
R0022:Dclre1b UTSW 3 103803148 missense probably benign 0.03
R0022:Dclre1b UTSW 3 103803148 missense probably benign 0.03
R1173:Dclre1b UTSW 3 103803876 missense probably benign 0.00
R1997:Dclre1b UTSW 3 103803356 missense probably benign 0.02
R2051:Dclre1b UTSW 3 103809040 missense possibly damaging 0.68
R2914:Dclre1b UTSW 3 103808114 missense probably damaging 0.98
R3420:Dclre1b UTSW 3 103808096 missense probably damaging 1.00
R4250:Dclre1b UTSW 3 103804084 intron probably null
R4474:Dclre1b UTSW 3 103807243 unclassified probably benign
R4866:Dclre1b UTSW 3 103808096 missense probably damaging 0.99
R5098:Dclre1b UTSW 3 103809136 unclassified probably benign
R5375:Dclre1b UTSW 3 103803974 missense probably damaging 1.00
R5796:Dclre1b UTSW 3 103807457 nonsense probably null
R5888:Dclre1b UTSW 3 103803737 missense probably damaging 1.00
R6189:Dclre1b UTSW 3 103803533 missense probably damaging 1.00
R6356:Dclre1b UTSW 3 103808155 missense probably damaging 1.00
R6443:Dclre1b UTSW 3 103803188 missense possibly damaging 0.82
R7471:Dclre1b UTSW 3 103803114 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCGTATGGTCCACAGCATG -3'
(R):5'- ACAGCGCTTGATGCTTGGTAG -3'

Sequencing Primer
(F):5'- TGGATGCGCCCGGCTTC -3'
(R):5'- GCACCTTGATAAACTTCTTGG -3'
Posted On2015-06-12