Incidental Mutation 'R4247:Akna'
ID320454
Institutional Source Beutler Lab
Gene Symbol Akna
Ensembl Gene ENSMUSG00000039158
Gene NameAT-hook transcription factor
Synonyms
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4247 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location63367125-63403354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63395172 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 238 (G238D)
Ref Sequence ENSEMBL: ENSMUSP00000041614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035724]
Predicted Effect probably benign
Transcript: ENSMUST00000035724
AA Change: G238D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041614
Gene: ENSMUSG00000039158
AA Change: G238D

DomainStartEndE-ValueType
low complexity region 140 153 N/A INTRINSIC
coiled coil region 423 458 N/A INTRINSIC
Pfam:AKNA 584 681 4.6e-37 PFAM
low complexity region 760 774 N/A INTRINSIC
low complexity region 1015 1029 N/A INTRINSIC
coiled coil region 1044 1066 N/A INTRINSIC
low complexity region 1296 1317 N/A INTRINSIC
low complexity region 1319 1343 N/A INTRINSIC
coiled coil region 1353 1386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144095
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic or a knock-out allele exhibit partial postnatal lethality, pathogen-induced acute neutrophil responses leading to systemic inflammation and alveolar destruction, and increased susceptibility to fungal infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Akna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Akna APN 4 63397873 critical splice donor site probably null
IGL00590:Akna APN 4 63371878 missense probably benign 0.00
IGL01567:Akna APN 4 63381850 missense probably benign
IGL01667:Akna APN 4 63379159 missense probably benign 0.34
IGL01820:Akna APN 4 63386258 missense probably benign 0.30
IGL01956:Akna APN 4 63379290 missense probably benign 0.04
IGL02148:Akna APN 4 63382479 splice site probably benign
IGL02502:Akna APN 4 63368203 missense probably benign 0.28
IGL02674:Akna APN 4 63370944 nonsense probably null
IGL02792:Akna APN 4 63377706 missense possibly damaging 0.73
IGL02956:Akna APN 4 63386279 missense probably benign 0.05
R0035:Akna UTSW 4 63382445 missense probably benign 0.16
R0049:Akna UTSW 4 63394635 missense probably damaging 0.97
R0133:Akna UTSW 4 63379361 nonsense probably null
R0396:Akna UTSW 4 63392126 splice site probably benign
R0422:Akna UTSW 4 63392154 missense probably damaging 1.00
R0578:Akna UTSW 4 63370910 missense probably benign
R0784:Akna UTSW 4 63376888 missense probably benign
R1264:Akna UTSW 4 63381725 splice site probably null
R1539:Akna UTSW 4 63379310 missense probably benign 0.00
R1575:Akna UTSW 4 63379333 missense probably benign 0.01
R1646:Akna UTSW 4 63383892 missense probably benign
R2115:Akna UTSW 4 63395160 missense probably benign 0.01
R2121:Akna UTSW 4 63376900 missense probably benign 0.08
R2324:Akna UTSW 4 63371802 missense possibly damaging 0.92
R2961:Akna UTSW 4 63394944 missense probably benign 0.04
R3150:Akna UTSW 4 63395353 missense possibly damaging 0.80
R3552:Akna UTSW 4 63398124 start codon destroyed probably null 0.53
R3855:Akna UTSW 4 63373468 missense probably damaging 0.98
R4023:Akna UTSW 4 63374390 missense probably benign
R4299:Akna UTSW 4 63398032 missense possibly damaging 0.59
R4422:Akna UTSW 4 63387093 missense possibly damaging 0.86
R4499:Akna UTSW 4 63395041 missense probably benign
R4723:Akna UTSW 4 63387032 missense probably benign
R4743:Akna UTSW 4 63378613 missense probably damaging 1.00
R4780:Akna UTSW 4 63379254 missense probably benign
R4903:Akna UTSW 4 63374037 missense probably damaging 1.00
R4936:Akna UTSW 4 63395265 missense probably damaging 0.97
R5041:Akna UTSW 4 63387144 missense possibly damaging 0.67
R5276:Akna UTSW 4 63368203 missense possibly damaging 0.95
R5297:Akna UTSW 4 63381846 missense possibly damaging 0.93
R5546:Akna UTSW 4 63394959 missense probably benign 0.15
R5546:Akna UTSW 4 63395566 missense probably benign
R5773:Akna UTSW 4 63395070 missense probably benign 0.41
R5966:Akna UTSW 4 63394903 missense probably damaging 0.99
R6127:Akna UTSW 4 63368119 missense possibly damaging 0.67
R6176:Akna UTSW 4 63377732 missense probably benign 0.04
R6337:Akna UTSW 4 63374003 missense probably benign 0.00
R6701:Akna UTSW 4 63395280 missense probably benign
R6800:Akna UTSW 4 63398031 missense probably benign
R6931:Akna UTSW 4 63387102 missense probably benign 0.02
R7451:Akna UTSW 4 63378667 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTATTGCCCCAAGCCGAGTAC -3'
(R):5'- CTGTTGAACATAGCCGCAC -3'

Sequencing Primer
(F):5'- TACTCAGGGGGCTGACAG -3'
(R):5'- TAGCCGCACAAAGTCTTGG -3'
Posted On2015-06-12