Incidental Mutation 'R4247:Sumf1'
ID320462
Institutional Source Beutler Lab
Gene Symbol Sumf1
Ensembl Gene ENSMUSG00000030101
Gene Namesulfatase modifying factor 1
Synonyms
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4247 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location108107028-108185582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108155013 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 156 (V156G)
Ref Sequence ENSEMBL: ENSMUSP00000127537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032191] [ENSMUST00000167338] [ENSMUST00000172188]
Predicted Effect probably damaging
Transcript: ENSMUST00000032191
AA Change: V181G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032191
Gene: ENSMUSG00000030101
AA Change: V181G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 365 1.4e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167338
AA Change: V156G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127537
Gene: ENSMUSG00000030101
AA Change: V156G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 340 1.2e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171697
Predicted Effect probably benign
Transcript: ENSMUST00000172188
SMART Domains Protein: ENSMUSP00000132321
Gene: ENSMUSG00000030101

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
Pfam:FGE-sulfatase 85 149 9.5e-18 PFAM
Pfam:FGE-sulfatase 144 233 4.9e-30 PFAM
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of sulfate esters by oxidizing a cysteine residue in the substrate sulfatase to an active site 3-oxoalanine residue, which is also known as C-alpha-formylglycine. Mutations in this gene cause multiple sulfatase deficiency, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes lacking all sulfatase activities exhibit frequent early postnatal lethality and growth retardation, skeletal anomalies, neurological defects, and massive GAG accumulation and cell vacuolization in all tissues in association with systemic inflammation, apoptosis, and neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Sumf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Sumf1 APN 6 108176016 missense probably damaging 1.00
IGL01624:Sumf1 APN 6 108153201 missense probably damaging 1.00
IGL02146:Sumf1 APN 6 108173431 critical splice acceptor site probably null
R0594:Sumf1 UTSW 6 108173414 missense probably benign 0.31
R0633:Sumf1 UTSW 6 108144671 missense probably damaging 1.00
R1479:Sumf1 UTSW 6 108176058 missense probably damaging 1.00
R3036:Sumf1 UTSW 6 108153191 missense possibly damaging 0.92
R3054:Sumf1 UTSW 6 108153204 missense probably benign 0.14
R4246:Sumf1 UTSW 6 108155013 missense probably damaging 1.00
R4249:Sumf1 UTSW 6 108155013 missense probably damaging 1.00
R4574:Sumf1 UTSW 6 108108432 unclassified probably benign
R4853:Sumf1 UTSW 6 108185495 missense probably benign 0.00
R5146:Sumf1 UTSW 6 108185310 missense probably benign 0.12
R5764:Sumf1 UTSW 6 108118463 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCAGACCCTGTGACTAG -3'
(R):5'- TAAGTCTATGGCACTGATACTCTG -3'

Sequencing Primer
(F):5'- AGACCCTGTGACTAGGACTTC -3'
(R):5'- GTCTATGGCACTGATACTCTGTAAAG -3'
Posted On2015-06-12