Incidental Mutation 'R4247:Vmn2r73'
ID320467
Institutional Source Beutler Lab
Gene Symbol Vmn2r73
Ensembl Gene ENSMUSG00000070458
Gene Namevomeronasal 2, receptor 73
SynonymsEG620928
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4247 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85857547-85875938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85872675 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 152 (L152Q)
Ref Sequence ENSEMBL: ENSMUSP00000076687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077478]
Predicted Effect probably damaging
Transcript: ENSMUST00000077478
AA Change: L152Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076687
Gene: ENSMUSG00000070458
AA Change: L152Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.4e-30 PFAM
Pfam:NCD3G 508 560 5.9e-21 PFAM
Pfam:7tm_3 590 827 4.4e-51 PFAM
Meta Mutation Damage Score 0.0272 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Vmn2r73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Vmn2r73 APN 7 85857587 missense probably benign
IGL01151:Vmn2r73 APN 7 85857878 missense probably damaging 0.99
IGL01408:Vmn2r73 APN 7 85872247 missense probably benign 0.45
IGL01505:Vmn2r73 APN 7 85858059 nonsense probably null
IGL01731:Vmn2r73 APN 7 85857549 makesense probably null
IGL01818:Vmn2r73 APN 7 85869901 splice site probably benign
IGL02236:Vmn2r73 APN 7 85872694 missense probably benign 0.00
IGL02265:Vmn2r73 APN 7 85871639 missense probably benign 0.02
IGL02266:Vmn2r73 APN 7 85875799 missense possibly damaging 0.52
IGL02276:Vmn2r73 APN 7 85869772 critical splice donor site probably null
IGL02284:Vmn2r73 APN 7 85857915 missense possibly damaging 0.92
IGL02380:Vmn2r73 APN 7 85858175 missense probably benign 0.00
IGL02466:Vmn2r73 APN 7 85872876 missense probably damaging 1.00
IGL03172:Vmn2r73 APN 7 85858287 missense probably benign 0.01
IGL03179:Vmn2r73 APN 7 85870260 missense probably benign 0.04
R0077:Vmn2r73 UTSW 7 85875867 missense probably benign 0.00
R0311:Vmn2r73 UTSW 7 85871789 missense probably benign
R0413:Vmn2r73 UTSW 7 85871879 missense possibly damaging 0.68
R0494:Vmn2r73 UTSW 7 85872932 missense probably benign
R1523:Vmn2r73 UTSW 7 85870278 missense probably benign 0.02
R1618:Vmn2r73 UTSW 7 85875912 nonsense probably null
R1667:Vmn2r73 UTSW 7 85857681 missense probably benign 0.00
R1728:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1729:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R1747:Vmn2r73 UTSW 7 85858167 missense probably damaging 1.00
R1784:Vmn2r73 UTSW 7 85857878 missense probably damaging 1.00
R2152:Vmn2r73 UTSW 7 85857728 missense probably benign 0.03
R2395:Vmn2r73 UTSW 7 85857767 missense probably damaging 1.00
R2415:Vmn2r73 UTSW 7 85872223 missense probably damaging 1.00
R2926:Vmn2r73 UTSW 7 85871663 missense probably benign 0.17
R3719:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R3766:Vmn2r73 UTSW 7 85871990 missense probably benign
R3838:Vmn2r73 UTSW 7 85858050 missense probably benign 0.00
R3890:Vmn2r73 UTSW 7 85857936 missense probably benign
R4030:Vmn2r73 UTSW 7 85871836 missense possibly damaging 0.92
R4409:Vmn2r73 UTSW 7 85871560 missense probably damaging 0.97
R4427:Vmn2r73 UTSW 7 85857773 missense probably damaging 1.00
R4430:Vmn2r73 UTSW 7 85870241 missense probably benign
R4552:Vmn2r73 UTSW 7 85875847 missense probably benign 0.12
R4779:Vmn2r73 UTSW 7 85871715 nonsense probably null
R4906:Vmn2r73 UTSW 7 85857621 missense probably damaging 0.99
R4942:Vmn2r73 UTSW 7 85870374 missense probably damaging 1.00
R5280:Vmn2r73 UTSW 7 85857947 missense probably damaging 0.98
R5344:Vmn2r73 UTSW 7 85875838 missense probably benign 0.00
R5478:Vmn2r73 UTSW 7 85869788 missense probably damaging 1.00
R5527:Vmn2r73 UTSW 7 85858367 missense possibly damaging 0.65
R5691:Vmn2r73 UTSW 7 85858091 missense probably damaging 1.00
R5826:Vmn2r73 UTSW 7 85875748 missense possibly damaging 0.77
R6018:Vmn2r73 UTSW 7 85872667 missense possibly damaging 0.48
R6082:Vmn2r73 UTSW 7 85858221 missense probably benign 0.00
R6111:Vmn2r73 UTSW 7 85871789 missense probably benign
R6233:Vmn2r73 UTSW 7 85869891 missense probably benign 0.00
R6278:Vmn2r73 UTSW 7 85872932 missense probably benign
R6283:Vmn2r73 UTSW 7 85871841 missense probably benign 0.00
R6307:Vmn2r73 UTSW 7 85857620 missense probably damaging 1.00
R6413:Vmn2r73 UTSW 7 85870336 nonsense probably null
R6782:Vmn2r73 UTSW 7 85870355 missense probably benign 0.00
R6884:Vmn2r73 UTSW 7 85858005 missense probably benign 0.05
R6921:Vmn2r73 UTSW 7 85858238 missense probably benign 0.27
R7169:Vmn2r73 UTSW 7 85858455 nonsense probably null
R7206:Vmn2r73 UTSW 7 85872867 missense probably benign 0.03
R7311:Vmn2r73 UTSW 7 85871984 missense possibly damaging 0.80
X0023:Vmn2r73 UTSW 7 85858456 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AATACTGCGGATCCCTATTCCC -3'
(R):5'- CCAAGACCAACCATTTGATTTTCTC -3'

Sequencing Primer
(F):5'- GCGGATCCCTATTCCCATTTATG -3'
(R):5'- ACAGCCATATTTTACCCAACATTTC -3'
Posted On2015-06-12