Incidental Mutation 'R4247:Kif9'
ID320470
Institutional Source Beutler Lab
Gene Symbol Kif9
Ensembl Gene ENSMUSG00000032489
Gene Namekinesin family member 9
Synonyms
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R4247 (G1)
Quality Score208
Status Validated
Chromosome9
Chromosomal Location110476958-110525179 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 110495959 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061155] [ENSMUST00000084952] [ENSMUST00000197248] [ENSMUST00000198043]
Predicted Effect probably null
Transcript: ENSMUST00000061155
SMART Domains Protein: ENSMUSP00000057896
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000084952
SMART Domains Protein: ENSMUSP00000082016
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 7e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197248
SMART Domains Protein: ENSMUSP00000142734
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 608 6e-19 BLAST
low complexity region 651 668 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198043
SMART Domains Protein: ENSMUSP00000142689
Gene: ENSMUSG00000032489

DomainStartEndE-ValueType
KISc 4 348 1.25e-120 SMART
low complexity region 359 371 N/A INTRINSIC
Blast:KISc 372 476 5e-14 BLAST
low complexity region 489 501 N/A INTRINSIC
Meta Mutation Damage Score 0.686 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Kif9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Kif9 APN 9 110485070 missense probably benign 0.03
IGL02273:Kif9 APN 9 110510470 missense probably damaging 0.99
IGL02818:Kif9 APN 9 110485149 missense probably damaging 1.00
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0034:Kif9 UTSW 9 110519611 missense probably benign 0.23
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0047:Kif9 UTSW 9 110485038 missense probably benign 0.05
R0137:Kif9 UTSW 9 110485038 missense probably damaging 1.00
R0594:Kif9 UTSW 9 110511340 missense probably benign 0.22
R1503:Kif9 UTSW 9 110510438 missense possibly damaging 0.89
R1657:Kif9 UTSW 9 110489966 missense possibly damaging 0.82
R1826:Kif9 UTSW 9 110517633 missense probably benign 0.34
R1856:Kif9 UTSW 9 110517719 missense probably null 1.00
R2076:Kif9 UTSW 9 110485032 splice site probably null
R3407:Kif9 UTSW 9 110519140 missense probably damaging 1.00
R4487:Kif9 UTSW 9 110494484 missense probably null 1.00
R4515:Kif9 UTSW 9 110489867 missense probably benign 0.38
R4880:Kif9 UTSW 9 110501635 missense probably damaging 0.98
R5024:Kif9 UTSW 9 110483093 missense possibly damaging 0.81
R5093:Kif9 UTSW 9 110489897 missense probably damaging 1.00
R5181:Kif9 UTSW 9 110521268 missense probably damaging 1.00
R5362:Kif9 UTSW 9 110489944 missense probably damaging 0.99
R5379:Kif9 UTSW 9 110521303 missense probably benign 0.00
R5628:Kif9 UTSW 9 110514553 nonsense probably null
R5653:Kif9 UTSW 9 110524931 missense probably damaging 1.00
R5698:Kif9 UTSW 9 110510464 missense probably benign
R5758:Kif9 UTSW 9 110489879 missense probably damaging 1.00
R5986:Kif9 UTSW 9 110490026 missense probably benign 0.05
R6103:Kif9 UTSW 9 110489849 missense possibly damaging 0.82
R6247:Kif9 UTSW 9 110488544 missense possibly damaging 0.78
R6255:Kif9 UTSW 9 110517834 intron probably null
R6991:Kif9 UTSW 9 110494622 missense probably damaging 1.00
R7113:Kif9 UTSW 9 110506664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGCAAACCAGGAAGCG -3'
(R):5'- AAGAGTGCACGAAGGCTTGTC -3'

Sequencing Primer
(F):5'- TATTCTGTCCAGAGTGACCACAC -3'
(R):5'- ACGAAGGCTTGTCCCATG -3'
Posted On2015-06-12