Incidental Mutation 'R4247:Slitrk1'
ID320478
Institutional Source Beutler Lab
Gene Symbol Slitrk1
Ensembl Gene ENSMUSG00000075478
Gene NameSLIT and NTRK-like family, member 1
Synonyms3200001I04Rik
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4247 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location108908800-108914158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108912562 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 239 (V239A)
Ref Sequence ENSEMBL: ENSMUSP00000097897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100322]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100322
AA Change: V239A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097897
Gene: ENSMUSG00000075478
AA Change: V239A

DomainStartEndE-ValueType
LRR 81 104 1.37e2 SMART
LRR 105 128 1.37e1 SMART
LRR 129 152 4.57e0 SMART
LRR_TYP 153 176 2.75e-3 SMART
LRR 180 200 1.92e2 SMART
LRRCT 212 262 3.45e-5 SMART
LRRNT 340 376 4.28e0 SMART
LRR 374 397 1.86e1 SMART
LRR 398 421 1.49e1 SMART
LRR 422 445 2.68e1 SMART
LRR 446 469 4.98e-1 SMART
LRR_TYP 470 493 6.52e-5 SMART
LRR 494 517 3.46e2 SMART
LRRCT 529 579 3.91e-4 SMART
transmembrane domain 621 643 N/A INTRINSIC
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. However, the protein encoded by this gene lacks the region of homology to neurotrophin receptors. This protein is thought to be involved in neurite outgrowth. Mutations in this gene may be associated with Tourette syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display hypoactivity, reduced male body weight, elevated anxiety- and depression-like behavior, increased norepinephrine content in brain, and partial postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Slitrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Slitrk1 APN 14 108911837 missense probably damaging 1.00
IGL00949:Slitrk1 APN 14 108911809 missense probably damaging 0.98
IGL01556:Slitrk1 APN 14 108913018 missense probably damaging 1.00
IGL01924:Slitrk1 APN 14 108911239 missense probably benign 0.08
IGL02389:Slitrk1 APN 14 108912322 missense probably benign
IGL02619:Slitrk1 APN 14 108911917 missense probably benign 0.09
IGL02828:Slitrk1 APN 14 108911616 missense possibly damaging 0.63
R0070:Slitrk1 UTSW 14 108913317 start gained probably benign
R0135:Slitrk1 UTSW 14 108911629 missense probably benign 0.00
R0627:Slitrk1 UTSW 14 108912239 missense probably damaging 1.00
R1529:Slitrk1 UTSW 14 108913277 start codon destroyed probably benign 0.33
R1661:Slitrk1 UTSW 14 108911927 missense probably damaging 1.00
R1711:Slitrk1 UTSW 14 108913096 missense probably benign 0.21
R1960:Slitrk1 UTSW 14 108912190 missense probably damaging 0.96
R1961:Slitrk1 UTSW 14 108912190 missense probably damaging 0.96
R4394:Slitrk1 UTSW 14 108911303 missense probably benign 0.01
R5027:Slitrk1 UTSW 14 108912308 missense probably benign
R5241:Slitrk1 UTSW 14 108913012 missense probably benign 0.27
R5599:Slitrk1 UTSW 14 108911812 missense probably benign 0.00
R5835:Slitrk1 UTSW 14 108911572 missense possibly damaging 0.94
R6224:Slitrk1 UTSW 14 108912022 missense probably damaging 1.00
R6489:Slitrk1 UTSW 14 108911303 missense possibly damaging 0.63
R6504:Slitrk1 UTSW 14 108911697 missense probably benign 0.14
R7102:Slitrk1 UTSW 14 108912629 missense probably benign 0.01
R7346:Slitrk1 UTSW 14 108913159 missense possibly damaging 0.89
R7413:Slitrk1 UTSW 14 108911925 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCTCCATTTGGAACAGCCC -3'
(R):5'- AGTATGTGCCCATCACCCAC -3'

Sequencing Primer
(F):5'- ATTTGGAACAGCCCCTGGG -3'
(R):5'- CCACCTCGACCTCCGTG -3'
Posted On2015-06-12