Incidental Mutation 'R4247:Zfp945'
ID320483
Institutional Source Beutler Lab
Gene Symbol Zfp945
Ensembl Gene ENSMUSG00000059142
Gene Namezinc finger protein 945
SynonymsA630033E08Rik, C730040L01Rik
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4247 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location22846697-22867134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22850609 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 793 (G793D)
Ref Sequence ENSEMBL: ENSMUSP00000124123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088696] [ENSMUST00000150092] [ENSMUST00000160457]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088696
AA Change: G772D

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000086074
Gene: ENSMUSG00000059142
AA Change: G772D

DomainStartEndE-ValueType
KRAB 13 68 9.12e-18 SMART
ZnF_C2H2 210 232 1.45e-2 SMART
ZnF_C2H2 238 260 1.03e-2 SMART
ZnF_C2H2 266 288 1.76e-1 SMART
ZnF_C2H2 322 344 7.37e-4 SMART
ZnF_C2H2 350 372 1.5e-4 SMART
ZnF_C2H2 378 400 5.14e-3 SMART
ZnF_C2H2 406 428 9.73e-4 SMART
ZnF_C2H2 434 456 2.99e-4 SMART
ZnF_C2H2 462 484 4.54e-4 SMART
ZnF_C2H2 490 512 2.4e-3 SMART
ZnF_C2H2 518 540 1.38e-3 SMART
ZnF_C2H2 546 568 1.13e-4 SMART
ZnF_C2H2 574 596 5.59e-4 SMART
ZnF_C2H2 602 624 9.31e1 SMART
ZnF_C2H2 630 652 7.9e-4 SMART
ZnF_C2H2 658 680 3.69e-4 SMART
ZnF_C2H2 686 708 3.16e-3 SMART
ZnF_C2H2 714 736 2.95e-3 SMART
ZnF_C2H2 742 764 1.98e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000095615
Predicted Effect probably benign
Transcript: ENSMUST00000150092
SMART Domains Protein: ENSMUSP00000117978
Gene: ENSMUSG00000059142

DomainStartEndE-ValueType
KRAB 34 89 9.12e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160457
AA Change: G793D

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124123
Gene: ENSMUSG00000059142
AA Change: G793D

DomainStartEndE-ValueType
KRAB 34 89 9.12e-18 SMART
ZnF_C2H2 231 253 1.45e-2 SMART
ZnF_C2H2 259 281 1.03e-2 SMART
ZnF_C2H2 287 309 1.76e-1 SMART
ZnF_C2H2 343 365 7.37e-4 SMART
ZnF_C2H2 371 393 1.5e-4 SMART
ZnF_C2H2 399 421 5.14e-3 SMART
ZnF_C2H2 427 449 9.73e-4 SMART
ZnF_C2H2 455 477 2.99e-4 SMART
ZnF_C2H2 483 505 4.54e-4 SMART
ZnF_C2H2 511 533 2.4e-3 SMART
ZnF_C2H2 539 561 1.38e-3 SMART
ZnF_C2H2 567 589 1.13e-4 SMART
ZnF_C2H2 595 617 5.59e-4 SMART
ZnF_C2H2 623 645 9.31e1 SMART
ZnF_C2H2 651 673 7.9e-4 SMART
ZnF_C2H2 679 701 3.69e-4 SMART
ZnF_C2H2 707 729 3.16e-3 SMART
ZnF_C2H2 735 757 2.95e-3 SMART
ZnF_C2H2 763 785 1.98e-4 SMART
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Gnal C G 18: 67,088,583 P19R unknown Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Zfp945
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Zfp945 APN 17 22851957 unclassified probably benign
IGL01077:Zfp945 APN 17 22852385 missense probably damaging 0.99
IGL02706:Zfp945 APN 17 22857282 missense probably damaging 1.00
IGL03408:Zfp945 APN 17 22852537 nonsense probably null
small-scale UTSW 17 22850981 missense probably damaging 1.00
R0427:Zfp945 UTSW 17 22865252 missense probably benign 0.10
R0718:Zfp945 UTSW 17 22851030 missense probably damaging 1.00
R1305:Zfp945 UTSW 17 22852386 missense probably damaging 0.97
R1801:Zfp945 UTSW 17 22851762 missense probably damaging 0.97
R1837:Zfp945 UTSW 17 22851273 missense probably damaging 1.00
R2001:Zfp945 UTSW 17 22857249 critical splice donor site probably null
R4193:Zfp945 UTSW 17 22851170 unclassified probably benign
R5026:Zfp945 UTSW 17 22850885 missense probably damaging 1.00
R5918:Zfp945 UTSW 17 22850981 missense probably damaging 1.00
R6076:Zfp945 UTSW 17 22851458 missense probably damaging 1.00
R6664:Zfp945 UTSW 17 22852365 missense probably damaging 0.99
R6997:Zfp945 UTSW 17 22852569 nonsense probably null
R7040:Zfp945 UTSW 17 22852290 missense probably damaging 0.98
R7479:Zfp945 UTSW 17 22851366 missense possibly damaging 0.93
R7566:Zfp945 UTSW 17 22851753 missense possibly damaging 0.71
X0063:Zfp945 UTSW 17 22852228 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATGAGGGATATTCTAAGAGGTGTGCC -3'
(R):5'- AATGTGGTAATTGCGACAGATC -3'

Sequencing Primer
(F):5'- CTAAGACAGCCTTTCTGGGTAAAAG -3'
(R):5'- GCGACAGATCTTTTACAAGTGGCTC -3'
Posted On2015-06-12