Incidental Mutation 'R4248:Moxd2'
ID320492
Institutional Source Beutler Lab
Gene Symbol Moxd2
Ensembl Gene ENSMUSG00000029885
Gene Namemonooxygenase, DBH-like 2
SynonymsDbhl1
MMRRC Submission 041064-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4248 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location40878794-40887494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 40878999 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 552 (I552S)
Ref Sequence ENSEMBL: ENSMUSP00000031937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031937]
Predicted Effect probably damaging
Transcript: ENSMUST00000031937
AA Change: I552S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031937
Gene: ENSMUSG00000029885
AA Change: I552S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
DoH 66 156 1.43e-12 SMART
Pfam:Cu2_monooxygen 192 316 8.3e-39 PFAM
Pfam:Cu2_monoox_C 336 493 1.8e-37 PFAM
Meta Mutation Damage Score 0.0776 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,472,956 N36S possibly damaging Het
Alox12b G A 11: 69,163,605 V250I probably benign Het
Armt1 T C 10: 4,439,687 F115L probably benign Het
Cdh9 T C 15: 16,850,388 F536L probably benign Het
Fbxo25 T C 8: 13,939,617 S355P probably damaging Het
Fhod3 A G 18: 24,990,066 K271R probably null Het
Gapt C A 13: 110,353,755 V125F probably damaging Het
Gucd1 A T 10: 75,509,828 V131E probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hivep2 A G 10: 14,131,555 E1299G probably damaging Het
Hnf4g A G 3: 3,652,849 D342G possibly damaging Het
Kmt2b C T 7: 30,574,064 R2349H probably benign Het
Lama5 C T 2: 180,180,427 R2896Q possibly damaging Het
Nkx1-2 TGGTGAGAGGGGGCCGCCTTGGCCCCG TG 7: 132,599,480 probably null Het
Olfr957 A G 9: 39,511,603 V39A probably benign Het
Onecut3 A G 10: 80,514,129 T486A possibly damaging Het
Pik3cb T C 9: 99,101,176 probably null Het
Pirb A G 7: 3,719,298 F182S probably damaging Het
Rev1 C T 1: 38,107,648 R34H possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Tep1 T C 14: 50,862,894 H389R possibly damaging Het
Tnfrsf1b G A 4: 145,215,965 A416V probably benign Het
Ust A T 10: 8,518,218 L61Q possibly damaging Het
Vmn2r101 A T 17: 19,589,114 K168N probably damaging Het
Other mutations in Moxd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Moxd2 APN 6 40884179 splice site probably benign
IGL02113:Moxd2 APN 6 40885404 missense probably benign 0.06
IGL02223:Moxd2 APN 6 40885033 missense probably damaging 1.00
IGL03204:Moxd2 APN 6 40887305 missense probably benign 0.04
IGL03385:Moxd2 APN 6 40879018 missense probably damaging 1.00
R0084:Moxd2 UTSW 6 40879408 missense probably null 0.01
R1213:Moxd2 UTSW 6 40891897 unclassified probably benign
R1326:Moxd2 UTSW 6 40880354 missense probably benign 0.00
R1652:Moxd2 UTSW 6 40887403 missense probably damaging 1.00
R1940:Moxd2 UTSW 6 40883532 missense probably damaging 1.00
R2040:Moxd2 UTSW 6 40884953 splice site probably null
R2088:Moxd2 UTSW 6 40884967 missense probably damaging 1.00
R3018:Moxd2 UTSW 6 40878886 missense probably benign 0.01
R3962:Moxd2 UTSW 6 40885397 missense probably benign
R4438:Moxd2 UTSW 6 40884062 missense probably damaging 1.00
R4715:Moxd2 UTSW 6 40887247 missense probably damaging 1.00
R4732:Moxd2 UTSW 6 40878859 missense probably benign
R4733:Moxd2 UTSW 6 40878859 missense probably benign
R4760:Moxd2 UTSW 6 40891603 missense probably benign 0.06
R4851:Moxd2 UTSW 6 40878822 missense probably damaging 1.00
R5087:Moxd2 UTSW 6 40879336 missense probably damaging 1.00
R5187:Moxd2 UTSW 6 40879337 missense probably benign 0.18
R5339:Moxd2 UTSW 6 40885420 missense probably damaging 1.00
R5452:Moxd2 UTSW 6 40882114 splice site probably null
R5860:Moxd2 UTSW 6 40880407 missense probably damaging 1.00
R5973:Moxd2 UTSW 6 40878810 missense probably damaging 0.96
R6015:Moxd2 UTSW 6 40883754 missense probably damaging 1.00
R6316:Moxd2 UTSW 6 40883547 missense probably damaging 1.00
R7561:Moxd2 UTSW 6 40887403 missense probably damaging 1.00
X0052:Moxd2 UTSW 6 40882528 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGGTCAAATTGGCAAGCTG -3'
(R):5'- CTTTCCTGCATTGTAGAGGCTG -3'

Sequencing Primer
(F):5'- GAATCATACTCCAGTCTGCAGCATTG -3'
(R):5'- AGGCTGTTGCAGTCTCCCAG -3'
Posted On2015-06-12