Incidental Mutation 'R4166:Fmn1'
ID320563
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission 041639-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R4166 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 113636735 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 1327 (S1327N)
Ref Sequence ENSEMBL: ENSMUSP00000099606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081349] [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
Predicted Effect probably benign
Transcript: ENSMUST00000081349
AA Change: S1065N

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080093
Gene: ENSMUSG00000044042
AA Change: S1065N

DomainStartEndE-ValueType
Blast:FH2 25 641 N/A BLAST
SCOP:d1jvr__ 668 699 2e-3 SMART
FH2 757 1162 1.16e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099576
AA Change: S1291N

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: S1291N

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102547
AA Change: S1327N

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: S1327N

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161731
AA Change: S1193N

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: S1193N

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185668
AA Change: S1140N
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,660,955 T1018A possibly damaging Het
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Ankrd35 T A 3: 96,679,155 probably null Het
Arhgap20 G A 9: 51,826,835 probably null Het
Bhmt T A 13: 93,625,499 probably benign Het
Cacna1b C A 2: 24,677,911 R1055L probably benign Het
Cdk5r1 A G 11: 80,478,209 Y234C probably damaging Het
Cdx2 G T 5: 147,306,729 A85D possibly damaging Het
Cenpe G A 3: 135,243,718 G88D probably damaging Het
Dennd5a A C 7: 109,926,825 probably null Het
Erich6 G A 3: 58,618,808 A591V probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fbln5 A G 12: 101,757,359 V374A probably damaging Het
Fnip2 A T 3: 79,462,135 V1081E probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Gulp1 T A 1: 44,708,669 Y27* probably null Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Msi2 T C 11: 88,347,088 H346R probably benign Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Npr3 T G 15: 11,848,513 E202A probably benign Het
Nsun4 A T 4: 116,034,051 L377Q probably damaging Het
Olfr293 C A 7: 86,664,394 T244N probably damaging Het
Oog2 A C 4: 144,194,841 H107P probably damaging Het
Otof A G 5: 30,382,418 L1032P probably damaging Het
Pcdh9 T A 14: 93,887,520 R405* probably null Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prol1 A T 5: 88,328,671 I307F unknown Het
Pycr1 T C 11: 120,642,123 I104V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rb1cc1 T C 1: 6,265,663 probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Skint3 A G 4: 112,255,635 I147M possibly damaging Het
Slc22a14 T G 9: 119,178,432 M304L probably benign Het
Slc22a14 T C 9: 119,179,868 N178S possibly damaging Het
Slc2a1 T G 4: 119,133,116 I179S probably damaging Het
Slco2b1 G T 7: 99,660,126 T666N probably benign Het
Smap1 T C 1: 23,848,425 M258V probably benign Het
Smr3a A T 5: 88,008,154 probably benign Het
Stt3b T A 9: 115,254,901 E402D probably damaging Het
Sync T C 4: 129,306,742 probably benign Het
Tbx20 T A 9: 24,769,744 I151F probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trank1 C A 9: 111,373,524 Y1652* probably null Het
Trim34a T A 7: 104,261,016 C342S probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Zfp146 A G 7: 30,162,440 V59A possibly damaging Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACTGCAAATATCCATGTTCCCAAAG -3'
(R):5'- GGTCATTCAGGGAGTAAGTGGC -3'

Sequencing Primer
(F):5'- TATCCATGTTCCCAAAGAGAGG -3'
(R):5'- TCATTCAGGGAGTAAGTGGCAATGG -3'
Posted On2015-06-12