Incidental Mutation 'R4166:Ankrd35'
ID320566
Institutional Source Beutler Lab
Gene Symbol Ankrd35
Ensembl Gene ENSMUSG00000038354
Gene Nameankyrin repeat domain 35
Synonyms4732436F15Rik
MMRRC Submission 041639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4166 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96670131-96691032 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 96679155 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048427] [ENSMUST00000122960]
Predicted Effect probably null
Transcript: ENSMUST00000048427
SMART Domains Protein: ENSMUSP00000047244
Gene: ENSMUSG00000038354

DomainStartEndE-ValueType
ANK 53 82 4.03e-5 SMART
ANK 86 115 6.46e-4 SMART
ANK 119 148 4.36e-1 SMART
ANK 152 181 1.4e-4 SMART
ANK 185 214 2.25e-3 SMART
ANK 218 247 6.24e2 SMART
coiled coil region 294 339 N/A INTRINSIC
low complexity region 438 455 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
coiled coil region 606 653 N/A INTRINSIC
coiled coil region 729 799 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 847 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130429
Meta Mutation Damage Score 0.6112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,660,955 T1018A possibly damaging Het
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Arhgap20 G A 9: 51,826,835 probably null Het
Bhmt T A 13: 93,625,499 probably benign Het
Cacna1b C A 2: 24,677,911 R1055L probably benign Het
Cdk5r1 A G 11: 80,478,209 Y234C probably damaging Het
Cdx2 G T 5: 147,306,729 A85D possibly damaging Het
Cenpe G A 3: 135,243,718 G88D probably damaging Het
Dennd5a A C 7: 109,926,825 probably null Het
Erich6 G A 3: 58,618,808 A591V probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fbln5 A G 12: 101,757,359 V374A probably damaging Het
Fmn1 G A 2: 113,636,735 S1327N probably benign Het
Fnip2 A T 3: 79,462,135 V1081E probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Gulp1 T A 1: 44,708,669 Y27* probably null Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Msi2 T C 11: 88,347,088 H346R probably benign Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Npr3 T G 15: 11,848,513 E202A probably benign Het
Nsun4 A T 4: 116,034,051 L377Q probably damaging Het
Olfr293 C A 7: 86,664,394 T244N probably damaging Het
Oog2 A C 4: 144,194,841 H107P probably damaging Het
Otof A G 5: 30,382,418 L1032P probably damaging Het
Pcdh9 T A 14: 93,887,520 R405* probably null Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prol1 A T 5: 88,328,671 I307F unknown Het
Pycr1 T C 11: 120,642,123 I104V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rb1cc1 T C 1: 6,265,663 probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Skint3 A G 4: 112,255,635 I147M possibly damaging Het
Slc22a14 T G 9: 119,178,432 M304L probably benign Het
Slc22a14 T C 9: 119,179,868 N178S possibly damaging Het
Slc2a1 T G 4: 119,133,116 I179S probably damaging Het
Slco2b1 G T 7: 99,660,126 T666N probably benign Het
Smap1 T C 1: 23,848,425 M258V probably benign Het
Smr3a A T 5: 88,008,154 probably benign Het
Stt3b T A 9: 115,254,901 E402D probably damaging Het
Sync T C 4: 129,306,742 probably benign Het
Tbx20 T A 9: 24,769,744 I151F probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trank1 C A 9: 111,373,524 Y1652* probably null Het
Trim34a T A 7: 104,261,016 C342S probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Zfp146 A G 7: 30,162,440 V59A possibly damaging Het
Other mutations in Ankrd35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Ankrd35 APN 3 96683034 splice site probably null
IGL00896:Ankrd35 APN 3 96684276 missense probably damaging 1.00
IGL01565:Ankrd35 APN 3 96684785 missense probably damaging 0.99
IGL01837:Ankrd35 APN 3 96680666 missense probably damaging 1.00
IGL02605:Ankrd35 APN 3 96681072 splice site probably null
IGL02819:Ankrd35 APN 3 96690208 missense possibly damaging 0.80
IGL02994:Ankrd35 APN 3 96682991 splice site probably benign
IGL03083:Ankrd35 APN 3 96684801 missense probably damaging 1.00
IGL03105:Ankrd35 APN 3 96684057 missense probably benign
FR4304:Ankrd35 UTSW 3 96683847 utr 3 prime probably benign
FR4342:Ankrd35 UTSW 3 96683515 frame shift probably null
FR4737:Ankrd35 UTSW 3 96683849 utr 3 prime probably benign
R0003:Ankrd35 UTSW 3 96684015 missense probably damaging 1.00
R0047:Ankrd35 UTSW 3 96684063 missense probably benign 0.00
R0551:Ankrd35 UTSW 3 96683960 missense probably benign 0.08
R1420:Ankrd35 UTSW 3 96684738 missense probably benign 0.13
R1455:Ankrd35 UTSW 3 96678155 missense probably damaging 1.00
R2201:Ankrd35 UTSW 3 96679248 missense possibly damaging 0.93
R3522:Ankrd35 UTSW 3 96685062 missense probably damaging 1.00
R3605:Ankrd35 UTSW 3 96682181 nonsense probably null
R4651:Ankrd35 UTSW 3 96684027 missense probably benign 0.00
R4668:Ankrd35 UTSW 3 96679208 missense probably damaging 1.00
R4916:Ankrd35 UTSW 3 96684122 missense probably benign
R4921:Ankrd35 UTSW 3 96684824 missense possibly damaging 0.61
R4953:Ankrd35 UTSW 3 96683673 missense possibly damaging 0.56
R5180:Ankrd35 UTSW 3 96680473 missense probably damaging 1.00
R5583:Ankrd35 UTSW 3 96684903 missense probably damaging 1.00
R5604:Ankrd35 UTSW 3 96684899 missense probably benign 0.02
R5613:Ankrd35 UTSW 3 96683018 missense possibly damaging 0.76
R6165:Ankrd35 UTSW 3 96683307 missense possibly damaging 0.93
R6413:Ankrd35 UTSW 3 96684813 missense probably damaging 0.96
R6711:Ankrd35 UTSW 3 96683468 nonsense probably null
R6834:Ankrd35 UTSW 3 96683283 missense possibly damaging 0.68
R6841:Ankrd35 UTSW 3 96670426 missense probably damaging 1.00
R7028:Ankrd35 UTSW 3 96683334 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCAGGGCTTATTAGAGCTTCC -3'
(R):5'- CTAGCCAAGACTGACTGAGC -3'

Sequencing Primer
(F):5'- GCTGGTACCTGCTTATAAGTTCAG -3'
(R):5'- ACAGCTGGAACCTGCATCTG -3'
Posted On2015-06-12