Incidental Mutation 'R4166:Msi2'
ID320594
Institutional Source Beutler Lab
Gene Symbol Msi2
Ensembl Gene ENSMUSG00000069769
Gene Namemusashi RNA-binding protein 2
Synonymsmsi2h, Musashi2
MMRRC Submission 041639-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4166 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location88339382-88718513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88347088 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 346 (H346R)
Ref Sequence ENSEMBL: ENSMUSP00000090470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092794] [ENSMUST00000107909]
Predicted Effect probably benign
Transcript: ENSMUST00000092794
AA Change: H346R

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090470
Gene: ENSMUSG00000069769
AA Change: H346R

DomainStartEndE-ValueType
RRM 22 94 3.53e-24 SMART
RRM 111 183 1.62e-23 SMART
low complexity region 241 260 N/A INTRINSIC
low complexity region 275 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107909
AA Change: H328R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103542
Gene: ENSMUSG00000069769
AA Change: H328R

DomainStartEndE-ValueType
RRM 22 94 3.53e-24 SMART
RRM 111 183 1.62e-23 SMART
low complexity region 241 260 N/A INTRINSIC
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the Musashi protein family. The encoded protein is transcriptional regulator that targets genes involved in development and cell cycle regulation. Mutations in this gene are associated with poor prognosis in certain types of cancers. This gene has also been shown to be rearranged in certain cancer cells. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality, decreased body size, and decreased hematopoietic stem cells. Mice homozygous for a conditional knock-out allele exhibit impaired hematopoietic stem cell physiology upon induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,660,955 T1018A possibly damaging Het
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Ankrd35 T A 3: 96,679,155 probably null Het
Arhgap20 G A 9: 51,826,835 probably null Het
Bhmt T A 13: 93,625,499 probably benign Het
Cacna1b C A 2: 24,677,911 R1055L probably benign Het
Cdk5r1 A G 11: 80,478,209 Y234C probably damaging Het
Cdx2 G T 5: 147,306,729 A85D possibly damaging Het
Cenpe G A 3: 135,243,718 G88D probably damaging Het
Dennd5a A C 7: 109,926,825 probably null Het
Erich6 G A 3: 58,618,808 A591V probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fbln5 A G 12: 101,757,359 V374A probably damaging Het
Fmn1 G A 2: 113,636,735 S1327N probably benign Het
Fnip2 A T 3: 79,462,135 V1081E probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Gulp1 T A 1: 44,708,669 Y27* probably null Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Npr3 T G 15: 11,848,513 E202A probably benign Het
Nsun4 A T 4: 116,034,051 L377Q probably damaging Het
Olfr293 C A 7: 86,664,394 T244N probably damaging Het
Oog2 A C 4: 144,194,841 H107P probably damaging Het
Otof A G 5: 30,382,418 L1032P probably damaging Het
Pcdh9 T A 14: 93,887,520 R405* probably null Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prol1 A T 5: 88,328,671 I307F unknown Het
Pycr1 T C 11: 120,642,123 I104V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rb1cc1 T C 1: 6,265,663 probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Skint3 A G 4: 112,255,635 I147M possibly damaging Het
Slc22a14 T G 9: 119,178,432 M304L probably benign Het
Slc22a14 T C 9: 119,179,868 N178S possibly damaging Het
Slc2a1 T G 4: 119,133,116 I179S probably damaging Het
Slco2b1 G T 7: 99,660,126 T666N probably benign Het
Smap1 T C 1: 23,848,425 M258V probably benign Het
Smr3a A T 5: 88,008,154 probably benign Het
Stt3b T A 9: 115,254,901 E402D probably damaging Het
Sync T C 4: 129,306,742 probably benign Het
Tbx20 T A 9: 24,769,744 I151F probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trank1 C A 9: 111,373,524 Y1652* probably null Het
Trim34a T A 7: 104,261,016 C342S probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Zfp146 A G 7: 30,162,440 V59A possibly damaging Het
Other mutations in Msi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
mikimoto UTSW 11 88366784 critical splice donor site probably null
mixmaster UTSW 11 88716580 missense probably damaging 1.00
miyamoto UTSW 11 88716580 missense probably damaging 1.00
P0027:Msi2 UTSW 11 88394597 missense probably damaging 1.00
R1366:Msi2 UTSW 11 88716580 missense probably damaging 1.00
R2208:Msi2 UTSW 11 88590108 missense probably damaging 1.00
R2414:Msi2 UTSW 11 88716547 missense probably damaging 1.00
R4151:Msi2 UTSW 11 88718044 missense probably damaging 1.00
R4494:Msi2 UTSW 11 88717359 missense possibly damaging 0.91
R4647:Msi2 UTSW 11 88718038 missense possibly damaging 0.83
R4952:Msi2 UTSW 11 88366784 critical splice donor site probably null
R4975:Msi2 UTSW 11 88394655 missense probably damaging 1.00
R5441:Msi2 UTSW 11 88479992 splice site probably benign
R5441:Msi2 UTSW 11 88718095 intron probably benign
R5715:Msi2 UTSW 11 88386063 missense probably damaging 1.00
R5768:Msi2 UTSW 11 88717738 missense probably damaging 1.00
T0722:Msi2 UTSW 11 88394597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCATGATTAAAAGCCGGAG -3'
(R):5'- CACGGTGTCTCAGAATTACATATTC -3'

Sequencing Primer
(F):5'- ATTTTTGATCCCTCTTCCTTTGAAAG -3'
(R):5'- TATTCATGCTGGCAACCATCAACTG -3'
Posted On2015-06-12