Incidental Mutation 'R4166:Tomm22'
ID320605
Institutional Source Beutler Lab
Gene Symbol Tomm22
Ensembl Gene ENSMUSG00000022427
Gene Nametranslocase of outer mitochondrial membrane 22
SynonymsTom22
MMRRC Submission 041639-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R4166 (G1)
Quality Score223
Status Validated
Chromosome15
Chromosomal Location79670861-79673400 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 79671005 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023061] [ENSMUST00000023062] [ENSMUST00000023064] [ENSMUST00000127292] [ENSMUST00000229502]
Predicted Effect probably benign
Transcript: ENSMUST00000023061
SMART Domains Protein: ENSMUSP00000023061
Gene: ENSMUSG00000022426

DomainStartEndE-ValueType
Josephin 30 190 2.4e-81 SMART
Predicted Effect unknown
Transcript: ENSMUST00000023062
AA Change: D38E
SMART Domains Protein: ENSMUSP00000023062
Gene: ENSMUSG00000022427
AA Change: D38E

DomainStartEndE-ValueType
Pfam:Tom22 9 121 1.8e-16 PFAM
low complexity region 126 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023064
SMART Domains Protein: ENSMUSP00000023064
Gene: ENSMUSG00000022428

DomainStartEndE-ValueType
Pfam:Chibby 1 116 1.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127292
Predicted Effect unknown
Transcript: ENSMUST00000229502
AA Change: D38E
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein of the mitochondrial outer membrane. The encoded protein interacts with TOMM20 and TOMM40, and forms a complex with several other proteins to import cytosolic preproteins into the mitochondrion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,660,955 T1018A possibly damaging Het
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Ankrd35 T A 3: 96,679,155 probably null Het
Arhgap20 G A 9: 51,826,835 probably null Het
Bhmt T A 13: 93,625,499 probably benign Het
Cacna1b C A 2: 24,677,911 R1055L probably benign Het
Cdk5r1 A G 11: 80,478,209 Y234C probably damaging Het
Cdx2 G T 5: 147,306,729 A85D possibly damaging Het
Cenpe G A 3: 135,243,718 G88D probably damaging Het
Dennd5a A C 7: 109,926,825 probably null Het
Erich6 G A 3: 58,618,808 A591V probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fbln5 A G 12: 101,757,359 V374A probably damaging Het
Fmn1 G A 2: 113,636,735 S1327N probably benign Het
Fnip2 A T 3: 79,462,135 V1081E probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Gulp1 T A 1: 44,708,669 Y27* probably null Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Msi2 T C 11: 88,347,088 H346R probably benign Het
Naip6 T A 13: 100,316,149 I135F probably benign Het
Npr3 T G 15: 11,848,513 E202A probably benign Het
Nsun4 A T 4: 116,034,051 L377Q probably damaging Het
Olfr293 C A 7: 86,664,394 T244N probably damaging Het
Oog2 A C 4: 144,194,841 H107P probably damaging Het
Otof A G 5: 30,382,418 L1032P probably damaging Het
Pcdh9 T A 14: 93,887,520 R405* probably null Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prol1 A T 5: 88,328,671 I307F unknown Het
Pycr1 T C 11: 120,642,123 I104V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rb1cc1 T C 1: 6,265,663 probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Skint3 A G 4: 112,255,635 I147M possibly damaging Het
Slc22a14 T G 9: 119,178,432 M304L probably benign Het
Slc22a14 T C 9: 119,179,868 N178S possibly damaging Het
Slc2a1 T G 4: 119,133,116 I179S probably damaging Het
Slco2b1 G T 7: 99,660,126 T666N probably benign Het
Smap1 T C 1: 23,848,425 M258V probably benign Het
Smr3a A T 5: 88,008,154 probably benign Het
Stt3b T A 9: 115,254,901 E402D probably damaging Het
Sync T C 4: 129,306,742 probably benign Het
Tbx20 T A 9: 24,769,744 I151F probably damaging Het
Trank1 C A 9: 111,373,524 Y1652* probably null Het
Trim34a T A 7: 104,261,016 C342S probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Zfp146 A G 7: 30,162,440 V59A possibly damaging Het
Other mutations in Tomm22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Tomm22 APN 15 79671898 missense probably damaging 1.00
R2264:Tomm22 UTSW 15 79671287 missense probably damaging 1.00
R3710:Tomm22 UTSW 15 79671218 missense probably damaging 1.00
R4165:Tomm22 UTSW 15 79671005 unclassified probably benign
R5268:Tomm22 UTSW 15 79671227 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACGCTTTCTCTCTAGCCAG -3'
(R):5'- TCGGGAAACATCTCCGTCAG -3'

Sequencing Primer
(F):5'- CTTCCGGAAGACGCTCTG -3'
(R):5'- ACAGGGTCTCGTCTAGCTG -3'
Posted On2015-06-12