Incidental Mutation 'R4168:Mogat1'
ID320642
Institutional Source Beutler Lab
Gene Symbol Mogat1
Ensembl Gene ENSMUSG00000012187
Gene Namemonoacylglycerol O-acyltransferase 1
Synonyms1110064N14Rik, mDC2, 0610030A14Rik, Dgat2l1, MGAT1
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location78510991-78538173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78512035 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 25 (V25A)
Ref Sequence ENSEMBL: ENSMUSP00000123427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012331] [ENSMUST00000113524] [ENSMUST00000134947] [ENSMUST00000149732] [ENSMUST00000152111] [ENSMUST00000170511]
Predicted Effect probably benign
Transcript: ENSMUST00000012331
AA Change: V25A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000012331
Gene: ENSMUSG00000012187
AA Change: V25A

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113524
AA Change: V25A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109152
Gene: ENSMUSG00000012187
AA Change: V25A

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134947
AA Change: V25A

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116178
Gene: ENSMUSG00000012187
AA Change: V25A

DomainStartEndE-ValueType
Pfam:DAGAT 40 201 2.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149732
SMART Domains Protein: ENSMUSP00000117903
Gene: ENSMUSG00000012187

DomainStartEndE-ValueType
Pfam:DAGAT 9 247 3.4e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000152111
AA Change: V25A

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123427
Gene: ENSMUSG00000012187
AA Change: V25A

DomainStartEndE-ValueType
Pfam:DAGAT 40 82 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170511
SMART Domains Protein: ENSMUSP00000132488
Gene: ENSMUSG00000090486

DomainStartEndE-ValueType
PDB:2M9U|A 43 87 3e-13 PDB
Pfam:TLV_coat 109 691 3.8e-147 PFAM
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acyl-CoA:monoacylglycerol acyltransferase (MOGAT; EC 2.3.1.22) catalyzes the synthesis of diacylglycerols, the precursor of physiologically important lipids such as triacylglycerol and phospholipids (Yen et al., 2002 [PubMed 12077311]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight in female, but not, male mice and does not ameliorate hepatic steatosis in lipodystrophic or obese mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Mogat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0056:Mogat1 UTSW 1 78523770 missense probably damaging 0.99
R0056:Mogat1 UTSW 1 78523770 missense probably damaging 0.99
R0105:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R0105:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R0357:Mogat1 UTSW 1 78512040 missense probably benign 0.01
R1146:Mogat1 UTSW 1 78523613 missense probably benign 0.09
R1146:Mogat1 UTSW 1 78523613 missense probably benign 0.09
R1716:Mogat1 UTSW 1 78538044 missense probably benign 0.01
R3799:Mogat1 UTSW 1 78529138 missense probably benign 0.00
R5485:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R5929:Mogat1 UTSW 1 78523733 missense probably benign 0.00
R6640:Mogat1 UTSW 1 78523774 missense probably damaging 0.99
R6841:Mogat1 UTSW 1 78522859 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCGAATTGGTTCCTTTCC -3'
(R):5'- CCTCGCTTTAGAAACAAAATAGTACGG -3'

Sequencing Primer
(F):5'- GAATTGGTTCCTTTCCGGCCAG -3'
(R):5'- CCAGGGCTACATAGAGGAAATATG -3'
Posted On2015-06-12