Incidental Mutation 'R4168:Zfp128'
ID320657
Institutional Source Beutler Lab
Gene Symbol Zfp128
Ensembl Gene ENSMUSG00000060397
Gene Namezinc finger protein 128
SynonymsmZnf8, 9630016P15Rik
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12881177-12893422 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12890362 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 219 (D219G)
Ref Sequence ENSEMBL: ENSMUSP00000115378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144578]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000081891
Predicted Effect probably benign
Transcript: ENSMUST00000144578
AA Change: D219G

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115378
Gene: ENSMUSG00000060397
AA Change: D219G

DomainStartEndE-ValueType
KRAB 25 85 2.51e-38 SMART
ZnF_C2H2 254 276 8.47e-4 SMART
ZnF_C2H2 282 304 5.21e-4 SMART
ZnF_C2H2 310 332 4.17e-3 SMART
ZnF_C2H2 338 360 3.89e-3 SMART
ZnF_C2H2 366 388 1.47e-3 SMART
ZnF_C2H2 394 416 8.47e-4 SMART
ZnF_C2H2 464 486 3.39e-3 SMART
Meta Mutation Damage Score 0.0904 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Zfp128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Zfp128 APN 7 12891022 missense probably benign 0.00
IGL01293:Zfp128 APN 7 12891424 makesense probably null
IGL02067:Zfp128 APN 7 12885050 missense possibly damaging 0.86
IGL02146:Zfp128 APN 7 12890032 missense possibly damaging 0.72
IGL02654:Zfp128 APN 7 12884679 missense possibly damaging 0.95
IGL03066:Zfp128 APN 7 12890117 missense probably benign 0.00
IGL03076:Zfp128 APN 7 12884709 missense possibly damaging 0.95
IGL03113:Zfp128 APN 7 12890387 missense probably benign 0.00
IGL03237:Zfp128 APN 7 12891026 missense probably benign 0.28
R0783:Zfp128 UTSW 7 12890272 missense probably damaging 1.00
R1686:Zfp128 UTSW 7 12890636 nonsense probably null
R1806:Zfp128 UTSW 7 12891022 missense probably benign 0.00
R2021:Zfp128 UTSW 7 12890029 missense possibly damaging 0.96
R3792:Zfp128 UTSW 7 12884732 missense probably damaging 0.98
R4105:Zfp128 UTSW 7 12884740 missense probably damaging 0.99
R4167:Zfp128 UTSW 7 12890362 missense probably benign 0.28
R5743:Zfp128 UTSW 7 12884727 missense probably damaging 1.00
R6266:Zfp128 UTSW 7 12890970 missense possibly damaging 0.80
R6799:Zfp128 UTSW 7 12890899 missense possibly damaging 0.93
R7102:Zfp128 UTSW 7 12890472 missense probably damaging 1.00
R7313:Zfp128 UTSW 7 12890534 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACCAGAGTAACTTGAATGACCC -3'
(R):5'- ATTCTGATTGAAGGCCCTCC -3'

Sequencing Primer
(F):5'- GTAACTTGAATGACCCCAAAGAG -3'
(R):5'- ATTCGCTCATGTTGAACAAGGG -3'
Posted On2015-06-12