Incidental Mutation 'R4169:Olfr220'
ID320677
Institutional Source Beutler Lab
Gene Symbol Olfr220
Ensembl Gene ENSMUSG00000066671
Gene Nameolfactory receptor 220
SynonymsEG546747, GA_x6K02SYWY4V-595-239, Olfr413-ps1, GA_x6K02T2P20D-20731742-20730694, MOR103-17, MOR103-13P
MMRRC Submission 041010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4169 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174442082-174451277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 174449596 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 324 (S324R)
Ref Sequence ENSEMBL: ENSMUSP00000141919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085861] [ENSMUST00000194229]
Predicted Effect unknown
Transcript: ENSMUST00000085861
AA Change: S324R
SMART Domains Protein: ENSMUSP00000083023
Gene: ENSMUSG00000066671
AA Change: S324R

DomainStartEndE-ValueType
Pfam:7tm_4 36 314 1.2e-51 PFAM
Pfam:7tm_1 46 295 3.6e-25 PFAM
low complexity region 315 325 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194229
AA Change: S324R
SMART Domains Protein: ENSMUSP00000141919
Gene: ENSMUSG00000066671
AA Change: S324R

DomainStartEndE-ValueType
Pfam:7tm_1 46 295 6e-33 PFAM
Pfam:7tm_4 144 288 1.4e-44 PFAM
low complexity region 315 325 N/A INTRINSIC
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 T C 4: 152,217,793 C121R probably damaging Het
Ampd1 T A 3: 103,094,841 M546K probably damaging Het
Birc3 T A 9: 7,849,683 D535V possibly damaging Het
Btn1a1 A G 13: 23,465,155 L9P probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Col4a2 C T 8: 11,429,391 P758L probably benign Het
Ddx50 A T 10: 62,640,770 Y241* probably null Het
Elk3 A G 10: 93,265,335 probably null Het
Fbn1 T C 2: 125,363,952 T1042A possibly damaging Het
Gm5445 A G 13: 12,378,646 noncoding transcript Het
Gnat3 T C 5: 18,003,864 F189L probably damaging Het
Hectd1 T C 12: 51,790,225 T815A probably damaging Het
Hmcn1 A C 1: 150,595,999 probably null Het
Hrc A G 7: 45,336,757 D444G probably benign Het
Ighv1-53 T A 12: 115,158,546 I70F possibly damaging Het
Kat7 A G 11: 95,280,472 F469L probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt81 T A 15: 101,461,312 M242L probably benign Het
Krtap6-1 A G 16: 89,031,696 probably null Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mthfr-ps1 T C 5: 78,474,589 noncoding transcript Het
Nop53 A T 7: 15,942,319 W152R probably benign Het
Olfr281 A G 15: 98,456,997 E229G probably benign Het
Olfr482 A T 7: 108,095,384 M62K probably damaging Het
Pcdh1 A T 18: 38,198,305 N548K probably damaging Het
Pcdhga12 A G 18: 37,766,414 I100V probably benign Het
Piezo2 T C 18: 63,050,604 H1743R probably benign Het
Pkdrej A G 15: 85,816,314 V1807A probably benign Het
Rabl2 T C 15: 89,590,379 M1V probably null Het
Rexo5 A G 7: 119,827,398 probably benign Het
Rfng C G 11: 120,783,946 G73R probably benign Het
Rps6ka4 A G 19: 6,831,820 L459P possibly damaging Het
Samd11 T A 4: 156,247,746 D536V probably damaging Het
Slc9a5 A G 8: 105,357,400 T451A possibly damaging Het
Snapc1 T A 12: 73,982,491 N349K probably benign Het
Sox1ot A G 8: 12,430,544 noncoding transcript Het
Tmem178 C T 17: 80,944,803 H39Y possibly damaging Het
Trav8n-2 A T 14: 53,346,418 T111S possibly damaging Het
Ttn T A 2: 76,872,759 probably benign Het
Ttn T C 2: 76,932,565 D3250G probably damaging Het
Ube2nl T A 7: 61,549,632 noncoding transcript Het
Vps25 T C 11: 101,254,092 S39P probably damaging Het
Zkscan14 G A 5: 145,196,175 T182I possibly damaging Het
Other mutations in Olfr220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Olfr220 APN 1 174448667 missense probably benign 0.00
IGL03369:Olfr220 APN 1 174448869 missense probably damaging 1.00
R1792:Olfr220 UTSW 1 174448737 missense probably benign
R4090:Olfr220 UTSW 1 174448934 missense probably benign 0.01
R4769:Olfr220 UTSW 1 174448958 missense possibly damaging 0.80
R6652:Olfr220 UTSW 1 174449061 missense probably damaging 1.00
R6930:Olfr220 UTSW 1 174449111 missense probably damaging 1.00
R7237:Olfr220 UTSW 1 174449339 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCGTCCTAAGCTCATGTATGCC -3'
(R):5'- GGCCATCGACCTAAGTATACC -3'

Sequencing Primer
(F):5'- GCCTACAATTCAAACAAAGTGGTGTC -3'
(R):5'- CATGTGCTTCATGTTGCCAG -3'
Posted On2015-06-12