Incidental Mutation 'R4169:Ampd1'
ID320683
Institutional Source Beutler Lab
Gene Symbol Ampd1
Ensembl Gene ENSMUSG00000070385
Gene Nameadenosine monophosphate deaminase 1
SynonymsAmpd-1
MMRRC Submission 041010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R4169 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103074014-103099720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103094841 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 546 (M546K)
Ref Sequence ENSEMBL: ENSMUSP00000143129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090715] [ENSMUST00000155034]
Predicted Effect probably damaging
Transcript: ENSMUST00000090715
AA Change: M546K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088217
Gene: ENSMUSG00000070385
AA Change: M546K

DomainStartEndE-ValueType
low complexity region 234 246 N/A INTRINSIC
Pfam:A_deaminase 294 701 5.4e-136 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155034
AA Change: M546K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143129
Gene: ENSMUSG00000070385
AA Change: M546K

DomainStartEndE-ValueType
low complexity region 234 246 N/A INTRINSIC
Pfam:A_deaminase 294 676 5.2e-103 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000177250
AA Change: M47K
SMART Domains Protein: ENSMUSP00000134772
Gene: ENSMUSG00000070385
AA Change: M47K

DomainStartEndE-ValueType
Pfam:A_deaminase 22 203 1.4e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199407
Meta Mutation Damage Score 0.346 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenosine monophosphate deaminase 1 catalyzes the deamination of AMP to IMP in skeletal muscle and plays an important role in the purine nucleotide cycle. Two other genes have been identified, AMPD2 and AMPD3, for the liver- and erythocyte-specific isoforms, respectively. Deficiency of the muscle-specific enzyme is apparently a common cause of exercise-induced myopathy and probably the most common cause of metabolic myopathy in the human. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 T C 4: 152,217,793 C121R probably damaging Het
Birc3 T A 9: 7,849,683 D535V possibly damaging Het
Btn1a1 A G 13: 23,465,155 L9P probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Col4a2 C T 8: 11,429,391 P758L probably benign Het
Ddx50 A T 10: 62,640,770 Y241* probably null Het
Elk3 A G 10: 93,265,335 probably null Het
Fbn1 T C 2: 125,363,952 T1042A possibly damaging Het
Gm5445 A G 13: 12,378,646 noncoding transcript Het
Gnat3 T C 5: 18,003,864 F189L probably damaging Het
Hectd1 T C 12: 51,790,225 T815A probably damaging Het
Hmcn1 A C 1: 150,595,999 probably null Het
Hrc A G 7: 45,336,757 D444G probably benign Het
Ighv1-53 T A 12: 115,158,546 I70F possibly damaging Het
Kat7 A G 11: 95,280,472 F469L probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt81 T A 15: 101,461,312 M242L probably benign Het
Krtap6-1 A G 16: 89,031,696 probably null Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mthfr-ps1 T C 5: 78,474,589 noncoding transcript Het
Nop53 A T 7: 15,942,319 W152R probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr281 A G 15: 98,456,997 E229G probably benign Het
Olfr482 A T 7: 108,095,384 M62K probably damaging Het
Pcdh1 A T 18: 38,198,305 N548K probably damaging Het
Pcdhga12 A G 18: 37,766,414 I100V probably benign Het
Piezo2 T C 18: 63,050,604 H1743R probably benign Het
Pkdrej A G 15: 85,816,314 V1807A probably benign Het
Rabl2 T C 15: 89,590,379 M1V probably null Het
Rexo5 A G 7: 119,827,398 probably benign Het
Rfng C G 11: 120,783,946 G73R probably benign Het
Rps6ka4 A G 19: 6,831,820 L459P possibly damaging Het
Samd11 T A 4: 156,247,746 D536V probably damaging Het
Slc9a5 A G 8: 105,357,400 T451A possibly damaging Het
Snapc1 T A 12: 73,982,491 N349K probably benign Het
Sox1ot A G 8: 12,430,544 noncoding transcript Het
Tmem178 C T 17: 80,944,803 H39Y possibly damaging Het
Trav8n-2 A T 14: 53,346,418 T111S possibly damaging Het
Ttn T A 2: 76,872,759 probably benign Het
Ttn T C 2: 76,932,565 D3250G probably damaging Het
Ube2nl T A 7: 61,549,632 noncoding transcript Het
Vps25 T C 11: 101,254,092 S39P probably damaging Het
Zkscan14 G A 5: 145,196,175 T182I possibly damaging Het
Other mutations in Ampd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Ampd1 APN 3 103099694 missense possibly damaging 0.64
IGL00909:Ampd1 APN 3 103088428 missense probably benign 0.10
IGL01543:Ampd1 APN 3 103095713 missense probably benign 0.00
IGL01743:Ampd1 APN 3 103094885 splice site probably benign
IGL02390:Ampd1 APN 3 103079041 missense probably benign 0.28
IGL02637:Ampd1 APN 3 103094883 splice site probably benign
IGL02735:Ampd1 APN 3 103085377 missense probably damaging 1.00
IGL03151:Ampd1 APN 3 103092470 splice site probably null
twinkle_toes UTSW 3 103095646 nonsense probably null
R0158:Ampd1 UTSW 3 103091730 nonsense probably null
R0441:Ampd1 UTSW 3 103088478 missense probably benign 0.05
R0646:Ampd1 UTSW 3 103099597 missense probably damaging 1.00
R1474:Ampd1 UTSW 3 103098838 missense probably damaging 1.00
R1499:Ampd1 UTSW 3 103091664 missense probably damaging 1.00
R1789:Ampd1 UTSW 3 103099126 missense possibly damaging 0.46
R2131:Ampd1 UTSW 3 103094878 critical splice donor site probably null
R3706:Ampd1 UTSW 3 103088311 splice site probably benign
R4007:Ampd1 UTSW 3 103092460 missense probably damaging 0.99
R4525:Ampd1 UTSW 3 103094733 missense probably damaging 1.00
R4828:Ampd1 UTSW 3 103081097 missense probably damaging 1.00
R5015:Ampd1 UTSW 3 103099665 missense possibly damaging 0.89
R5514:Ampd1 UTSW 3 103079172 missense possibly damaging 0.50
R5839:Ampd1 UTSW 3 103085428 missense possibly damaging 0.47
R5872:Ampd1 UTSW 3 103079130 missense probably benign 0.00
R5890:Ampd1 UTSW 3 103090075 missense probably damaging 1.00
R5986:Ampd1 UTSW 3 103085397 missense probably damaging 1.00
R6272:Ampd1 UTSW 3 103085383 missense possibly damaging 0.50
R6473:Ampd1 UTSW 3 103095646 nonsense probably null
R6504:Ampd1 UTSW 3 103099595 missense possibly damaging 0.90
R7051:Ampd1 UTSW 3 103090073 missense probably damaging 1.00
R7323:Ampd1 UTSW 3 103085380 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGCTGGCCATCACTGACTC -3'
(R):5'- ACCAAGCCTTCATTGTCTGACC -3'

Sequencing Primer
(F):5'- AGTTTCACTGAGTGCAGAGCC -3'
(R):5'- ATTGTCTGACCTCCTCGTGC -3'
Posted On2015-06-12