Incidental Mutation 'R4169:Rfng'
ID320706
Institutional Source Beutler Lab
Gene Symbol Rfng
Ensembl Gene ENSMUSG00000025158
Gene NameRFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Synonymsradical fringe
MMRRC Submission 041010-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4169 (G1)
Quality Score171
Status Validated
Chromosome11
Chromosomal Location120780746-120784207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 120783946 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 73 (G73R)
Ref Sequence ENSEMBL: ENSMUSP00000026156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026156] [ENSMUST00000100134] [ENSMUST00000116305] [ENSMUST00000153678] [ENSMUST00000172809] [ENSMUST00000208737]
Predicted Effect probably benign
Transcript: ENSMUST00000026156
AA Change: G73R

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000026156
Gene: ENSMUSG00000025158
AA Change: G73R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Fringe 54 306 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100134
SMART Domains Protein: ENSMUSP00000097711
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
Pfam:RPN7 123 305 4.9e-78 PFAM
PINT 356 439 5.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116305
SMART Domains Protein: ENSMUSP00000112007
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
Pfam:RPN7 123 305 1.3e-77 PFAM
PINT 356 439 5.77e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144519
Predicted Effect probably benign
Transcript: ENSMUST00000153678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156723
Predicted Effect probably benign
Transcript: ENSMUST00000172809
SMART Domains Protein: ENSMUSP00000133855
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 37 49 N/A INTRINSIC
Pfam:RPN7 162 344 8.8e-77 PFAM
PINT 395 478 5.77e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208737
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene display a completely normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 T C 4: 152,217,793 C121R probably damaging Het
Ampd1 T A 3: 103,094,841 M546K probably damaging Het
Birc3 T A 9: 7,849,683 D535V possibly damaging Het
Btn1a1 A G 13: 23,465,155 L9P probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Col4a2 C T 8: 11,429,391 P758L probably benign Het
Ddx50 A T 10: 62,640,770 Y241* probably null Het
Elk3 A G 10: 93,265,335 probably null Het
Fbn1 T C 2: 125,363,952 T1042A possibly damaging Het
Gm5445 A G 13: 12,378,646 noncoding transcript Het
Gnat3 T C 5: 18,003,864 F189L probably damaging Het
Hectd1 T C 12: 51,790,225 T815A probably damaging Het
Hmcn1 A C 1: 150,595,999 probably null Het
Hrc A G 7: 45,336,757 D444G probably benign Het
Ighv1-53 T A 12: 115,158,546 I70F possibly damaging Het
Kat7 A G 11: 95,280,472 F469L probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt81 T A 15: 101,461,312 M242L probably benign Het
Krtap6-1 A G 16: 89,031,696 probably null Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mthfr-ps1 T C 5: 78,474,589 noncoding transcript Het
Nop53 A T 7: 15,942,319 W152R probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr281 A G 15: 98,456,997 E229G probably benign Het
Olfr482 A T 7: 108,095,384 M62K probably damaging Het
Pcdh1 A T 18: 38,198,305 N548K probably damaging Het
Pcdhga12 A G 18: 37,766,414 I100V probably benign Het
Piezo2 T C 18: 63,050,604 H1743R probably benign Het
Pkdrej A G 15: 85,816,314 V1807A probably benign Het
Rabl2 T C 15: 89,590,379 M1V probably null Het
Rexo5 A G 7: 119,827,398 probably benign Het
Rps6ka4 A G 19: 6,831,820 L459P possibly damaging Het
Samd11 T A 4: 156,247,746 D536V probably damaging Het
Slc9a5 A G 8: 105,357,400 T451A possibly damaging Het
Snapc1 T A 12: 73,982,491 N349K probably benign Het
Sox1ot A G 8: 12,430,544 noncoding transcript Het
Tmem178 C T 17: 80,944,803 H39Y possibly damaging Het
Trav8n-2 A T 14: 53,346,418 T111S possibly damaging Het
Ttn T A 2: 76,872,759 probably benign Het
Ttn T C 2: 76,932,565 D3250G probably damaging Het
Ube2nl T A 7: 61,549,632 noncoding transcript Het
Vps25 T C 11: 101,254,092 S39P probably damaging Het
Zkscan14 G A 5: 145,196,175 T182I possibly damaging Het
Other mutations in Rfng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Rfng APN 11 120783952 missense probably damaging 0.99
IGL01073:Rfng APN 11 120783921 missense probably benign 0.01
IGL01748:Rfng APN 11 120783743 missense probably benign 0.00
R1533:Rfng UTSW 11 120781861 nonsense probably null
R2697:Rfng UTSW 11 120784039 unclassified probably benign
R4401:Rfng UTSW 11 120782480 missense possibly damaging 0.94
R4613:Rfng UTSW 11 120782650 missense probably damaging 1.00
R4738:Rfng UTSW 11 120783964 missense probably damaging 1.00
R5015:Rfng UTSW 11 120783050 missense probably damaging 0.98
R5703:Rfng UTSW 11 120782016 missense probably benign 0.40
R6191:Rfng UTSW 11 120782690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTCTGTGGGAGAAAACGC -3'
(R):5'- TGCTGTCACTCTTAAAGGGG -3'

Sequencing Primer
(F):5'- AAACGCCGTGAGTGGGTC -3'
(R):5'- TCACTCTTAAAGGGGCCGCC -3'
Posted On2015-06-12