Incidental Mutation 'R4169:Ighv1-53'
ID320709
Institutional Source Beutler Lab
Gene Symbol Ighv1-53
Ensembl Gene ENSMUSG00000093894
Gene Nameimmunoglobulin heavy variable 1-53
SynonymsAB069917, V23-D-J-C mu
MMRRC Submission 041010-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R4169 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location115158403-115158835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115158546 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 70 (I70F)
Ref Sequence ENSEMBL: ENSMUSP00000100304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103523]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103523
AA Change: I70F

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100304
Gene: ENSMUSG00000093894
AA Change: I70F

DomainStartEndE-ValueType
IGv 36 117 3.52e-31 SMART
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot7 T C 4: 152,217,793 C121R probably damaging Het
Ampd1 T A 3: 103,094,841 M546K probably damaging Het
Birc3 T A 9: 7,849,683 D535V possibly damaging Het
Btn1a1 A G 13: 23,465,155 L9P probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Col4a2 C T 8: 11,429,391 P758L probably benign Het
Ddx50 A T 10: 62,640,770 Y241* probably null Het
Elk3 A G 10: 93,265,335 probably null Het
Fbn1 T C 2: 125,363,952 T1042A possibly damaging Het
Gm5445 A G 13: 12,378,646 noncoding transcript Het
Gnat3 T C 5: 18,003,864 F189L probably damaging Het
Hectd1 T C 12: 51,790,225 T815A probably damaging Het
Hmcn1 A C 1: 150,595,999 probably null Het
Hrc A G 7: 45,336,757 D444G probably benign Het
Kat7 A G 11: 95,280,472 F469L probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Krt81 T A 15: 101,461,312 M242L probably benign Het
Krtap6-1 A G 16: 89,031,696 probably null Het
Man2c1 A G 9: 57,138,026 D473G probably benign Het
Mthfr-ps1 T C 5: 78,474,589 noncoding transcript Het
Nop53 A T 7: 15,942,319 W152R probably benign Het
Olfr220 T A 1: 174,449,596 S324R unknown Het
Olfr281 A G 15: 98,456,997 E229G probably benign Het
Olfr482 A T 7: 108,095,384 M62K probably damaging Het
Pcdh1 A T 18: 38,198,305 N548K probably damaging Het
Pcdhga12 A G 18: 37,766,414 I100V probably benign Het
Piezo2 T C 18: 63,050,604 H1743R probably benign Het
Pkdrej A G 15: 85,816,314 V1807A probably benign Het
Rabl2 T C 15: 89,590,379 M1V probably null Het
Rexo5 A G 7: 119,827,398 probably benign Het
Rfng C G 11: 120,783,946 G73R probably benign Het
Rps6ka4 A G 19: 6,831,820 L459P possibly damaging Het
Samd11 T A 4: 156,247,746 D536V probably damaging Het
Slc9a5 A G 8: 105,357,400 T451A possibly damaging Het
Snapc1 T A 12: 73,982,491 N349K probably benign Het
Sox1ot A G 8: 12,430,544 noncoding transcript Het
Tmem178 C T 17: 80,944,803 H39Y possibly damaging Het
Trav8n-2 A T 14: 53,346,418 T111S possibly damaging Het
Ttn T A 2: 76,872,759 probably benign Het
Ttn T C 2: 76,932,565 D3250G probably damaging Het
Ube2nl T A 7: 61,549,632 noncoding transcript Het
Vps25 T C 11: 101,254,092 S39P probably damaging Het
Zkscan14 G A 5: 145,196,175 T182I possibly damaging Het
Other mutations in Ighv1-53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01815:Ighv1-53 APN 12 115158597 missense probably benign 0.01
IGL02326:Ighv1-53 APN 12 115158615 missense probably benign 0.21
R3404:Ighv1-53 UTSW 12 115158438 missense possibly damaging 0.81
R4020:Ighv1-53 UTSW 12 115158822 missense probably benign 0.00
R4241:Ighv1-53 UTSW 12 115158822 missense probably benign 0.00
R5231:Ighv1-53 UTSW 12 115158605 missense probably benign 0.09
R7139:Ighv1-53 UTSW 12 115158821 nonsense probably null
R7220:Ighv1-53 UTSW 12 115158515 missense probably benign 0.00
R7293:Ighv1-53 UTSW 12 115158821 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGGCAGTTTGCTACTCATC -3'
(R):5'- TGACAATGACATCCACTTTGCC -3'

Sequencing Primer
(F):5'- CAGGGTTTCTGACACTCTCAGG -3'
(R):5'- GCCTTTCTCTCCACAGGTG -3'
Posted On2015-06-12