Incidental Mutation 'R0396:Lrrc45'
ID32071
Institutional Source Beutler Lab
Gene Symbol Lrrc45
Ensembl Gene ENSMUSG00000025145
Gene Nameleucine rich repeat containing 45
Synonyms
MMRRC Submission 038602-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R0396 (G1)
Quality Score207
Status Validated
Chromosome11
Chromosomal Location120713925-120721128 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 120714907 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026137] [ENSMUST00000026139] [ENSMUST00000055424] [ENSMUST00000106154] [ENSMUST00000106155] [ENSMUST00000145781] [ENSMUST00000151852]
Predicted Effect probably benign
Transcript: ENSMUST00000026137
SMART Domains Protein: ENSMUSP00000026137
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 55 107 3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026139
SMART Domains Protein: ENSMUSP00000026139
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 4e-11 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055424
SMART Domains Protein: ENSMUSP00000050335
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 8 78 7.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106154
SMART Domains Protein: ENSMUSP00000101760
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
Pfam:CENP-X 44 114 6.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106155
SMART Domains Protein: ENSMUSP00000101761
Gene: ENSMUSG00000025144

DomainStartEndE-ValueType
low complexity region 39 50 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128543
Predicted Effect probably benign
Transcript: ENSMUST00000145781
SMART Domains Protein: ENSMUSP00000123038
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
LRR 57 84 9.11e0 SMART
LRR 85 112 1.01e-1 SMART
Blast:LRR 113 142 1e-10 BLAST
LRR 143 170 4.47e-3 SMART
LRR 171 198 2.2e-2 SMART
LRR 199 226 1.66e2 SMART
coiled coil region 360 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150225
Predicted Effect probably benign
Transcript: ENSMUST00000151852
SMART Domains Protein: ENSMUSP00000115298
Gene: ENSMUSG00000025145

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
Pfam:LRR_6 85 108 1e-2 PFAM
Blast:LRR 113 142 3e-11 BLAST
Pfam:LRR_6 143 162 7.6e-3 PFAM
Pfam:LRR_1 145 159 6.8e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155187
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,268,377 V467A possibly damaging Het
4933405L10Rik G A 8: 105,709,780 V194I probably benign Het
Acsm1 A T 7: 119,636,455 I133F probably damaging Het
Adamts9 T A 6: 92,798,005 T1676S probably benign Het
Adcy4 T C 14: 55,772,288 D769G probably benign Het
Aif1 T C 17: 35,171,109 *148W probably null Het
Akna C T 4: 63,392,126 probably benign Het
Arhgap32 G A 9: 32,245,255 probably null Het
Atpaf1 G A 4: 115,785,252 E92K possibly damaging Het
C1s1 T C 6: 124,533,354 E378G probably benign Het
Caprin1 T A 2: 103,769,569 Q108L probably damaging Het
Car13 A T 3: 14,656,239 H154L probably benign Het
Cdon C A 9: 35,470,130 N605K probably damaging Het
Ceacam10 G A 7: 24,781,014 G70E probably damaging Het
Cfap221 G A 1: 119,954,200 T286M probably benign Het
Cfap61 T C 2: 145,949,944 F107S possibly damaging Het
Coil C A 11: 88,981,623 T270N probably benign Het
Crocc2 T G 1: 93,224,214 probably benign Het
Crot T C 5: 8,969,959 E461G probably damaging Het
D130052B06Rik G T 11: 33,623,391 R41L unknown Het
D630045J12Rik T C 6: 38,196,736 S166G possibly damaging Het
Dennd4a T G 9: 64,862,391 V460G probably damaging Het
Depdc7 A T 2: 104,727,323 probably benign Het
Dgkb G A 12: 38,190,135 probably null Het
Dhx57 T G 17: 80,274,797 S407R probably benign Het
Dnase2a G T 8: 84,909,763 probably benign Het
Dqx1 T G 6: 83,059,005 M106R probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Ephx2 T G 14: 66,108,063 I151L probably benign Het
Gdf3 C T 6: 122,607,135 G91D probably damaging Het
Gm14124 G A 2: 150,268,053 G221D probably damaging Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gsdme T A 6: 50,221,107 H291L probably benign Het
H2-Bl A G 17: 36,083,722 I103T possibly damaging Het
Hif3a G A 7: 17,052,021 probably benign Het
Hmox2 A T 16: 4,765,763 I232L probably benign Het
Itgb2 A G 10: 77,561,189 Y686C probably damaging Het
Jmjd1c A G 10: 67,219,523 T528A possibly damaging Het
Kdr T C 5: 75,960,728 I541V possibly damaging Het
Khdrbs2 C A 1: 32,519,973 V343L probably damaging Het
Kif16b C T 2: 142,853,659 R175H probably damaging Het
Klri2 T G 6: 129,740,288 E44A possibly damaging Het
Kmt2b G T 7: 30,576,755 T1773K probably damaging Het
Lair1 A G 7: 4,010,786 L154P probably damaging Het
Larp1b G A 3: 40,970,561 V158M probably damaging Het
Lgi3 T A 14: 70,534,840 I275N probably damaging Het
Lrba A G 3: 86,295,179 N246D probably damaging Het
Mdh2 G T 5: 135,789,679 V263L probably benign Het
Myom1 T A 17: 71,034,693 V149E probably damaging Het
Nanos1 A T 19: 60,757,041 D259V probably damaging Het
Nedd4l T A 18: 65,161,654 probably benign Het
Npas3 A G 12: 53,831,745 Y150C probably damaging Het
Olfr1066 T C 2: 86,456,019 N84S possibly damaging Het
Olfr1129 T A 2: 87,575,567 V161D possibly damaging Het
Olfr1392 A T 11: 49,293,338 I6F probably benign Het
Olfr479 A T 7: 108,055,963 H327L probably benign Het
Olfr672 G A 7: 104,996,706 A66V probably damaging Het
Olfr93 C T 17: 37,151,555 C139Y probably damaging Het
Pde4c A G 8: 70,750,076 N637S probably benign Het
Pds5b T A 5: 150,779,275 V824D possibly damaging Het
Pole2 A T 12: 69,222,386 probably benign Het
Ppig C T 2: 69,735,976 probably benign Het
Prep A G 10: 45,092,676 Y90C probably damaging Het
Proca1 A T 11: 78,194,905 R11S probably damaging Het
Prph T A 15: 99,056,991 W313R probably benign Het
Prune2 C T 19: 17,123,080 P1983S probably benign Het
Ptbp2 G A 3: 119,724,198 probably benign Het
Rsph6a C T 7: 19,074,106 P398L probably damaging Het
Sdk2 T C 11: 113,829,967 I1379V probably benign Het
Sf3b1 C T 1: 55,019,271 G53E probably damaging Het
Slc9a3 T C 13: 74,157,784 probably null Het
Smarcal1 A T 1: 72,626,473 H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,150,707 probably benign Het
Sptan1 T C 2: 29,991,033 V438A probably damaging Het
Sstr4 T A 2: 148,396,261 V264D probably damaging Het
Susd2 A G 10: 75,639,911 L418P probably damaging Het
Synj1 A G 16: 90,938,640 V1475A probably benign Het
Szt2 G A 4: 118,376,347 probably benign Het
Tbc1d4 T C 14: 101,458,063 probably null Het
Tesk1 A G 4: 43,446,000 E311G probably damaging Het
Tmed5 A T 5: 108,126,016 V119E probably damaging Het
Tmem260 T C 14: 48,486,867 S201P possibly damaging Het
Tnxb A G 17: 34,671,733 Y350C probably damaging Het
Tpte T C 8: 22,335,608 probably benign Het
Trim37 A T 11: 87,146,968 D161V probably damaging Het
Trrap C A 5: 144,814,556 Q1640K probably damaging Het
Tspoap1 T C 11: 87,776,346 probably benign Het
Ttk T A 9: 83,847,260 probably benign Het
Vmn1r172 A G 7: 23,660,532 S281G probably benign Het
Vmn1r177 A G 7: 23,865,597 S285P probably damaging Het
Vmn1r231 C T 17: 20,890,399 V85I probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r118 T C 17: 55,608,643 I436V probably benign Het
Vmn2r12 T C 5: 109,092,899 K116R probably benign Het
Vmn2r28 T A 7: 5,488,514 I245L probably benign Het
Wdr26 A T 1: 181,180,651 probably benign Het
Xrcc3 A T 12: 111,809,957 H67Q probably benign Het
Zbbx A T 3: 75,078,495 S417T possibly damaging Het
Zc3h13 A G 14: 75,323,482 D504G unknown Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zyg11b A T 4: 108,255,308 F388I probably damaging Het
Other mutations in Lrrc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Lrrc45 APN 11 120720610 splice site probably benign
IGL01120:Lrrc45 APN 11 120720010 missense probably benign
IGL01536:Lrrc45 APN 11 120715584 missense probably benign 0.01
IGL01839:Lrrc45 APN 11 120717149 unclassified probably null
IGL02190:Lrrc45 APN 11 120718508 missense probably damaging 0.99
IGL02302:Lrrc45 APN 11 120718525 missense possibly damaging 0.68
IGL02724:Lrrc45 APN 11 120718318 missense probably benign 0.25
R0420:Lrrc45 UTSW 11 120715219 missense probably damaging 1.00
R0540:Lrrc45 UTSW 11 120715162 nonsense probably null
R0833:Lrrc45 UTSW 11 120718193 unclassified probably null
R0942:Lrrc45 UTSW 11 120718238 unclassified probably benign
R1252:Lrrc45 UTSW 11 120715471 missense probably benign 0.13
R1426:Lrrc45 UTSW 11 120720013 missense probably benign 0.00
R1543:Lrrc45 UTSW 11 120720018 missense probably benign 0.06
R1570:Lrrc45 UTSW 11 120720109 critical splice donor site probably null
R2392:Lrrc45 UTSW 11 120719539 missense probably benign 0.00
R3000:Lrrc45 UTSW 11 120718447 missense probably benign 0.00
R3930:Lrrc45 UTSW 11 120718677 missense probably benign 0.06
R4158:Lrrc45 UTSW 11 120718446 missense possibly damaging 0.52
R4161:Lrrc45 UTSW 11 120718446 missense possibly damaging 0.52
R4432:Lrrc45 UTSW 11 120715221 critical splice donor site probably null
R4647:Lrrc45 UTSW 11 120719121 missense probably benign 0.02
R6030:Lrrc45 UTSW 11 120720648 nonsense probably null
R6030:Lrrc45 UTSW 11 120720648 nonsense probably null
R6220:Lrrc45 UTSW 11 120719527 missense probably benign 0.37
X0026:Lrrc45 UTSW 11 120720232 missense probably damaging 1.00
Z1088:Lrrc45 UTSW 11 120720231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTGGGAACAGAGGTCAGTGTC -3'
(R):5'- TCGGAGGTTGTTGCCCTACAAAAG -3'

Sequencing Primer
(F):5'- TAGAGAAGCCTTAATGTTCCCAGC -3'
(R):5'- GGCTCTGGATACCACATTTGAAC -3'
Posted On2013-04-24