Incidental Mutation 'R4230:Cog6'
ID320771
Institutional Source Beutler Lab
Gene Symbol Cog6
Ensembl Gene ENSMUSG00000027742
Gene Namecomponent of oligomeric golgi complex 6
Synonyms
MMRRC Submission 041049-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.469) question?
Stock #R4230 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location52981875-53017237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52992808 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 511 (T511A)
Ref Sequence ENSEMBL: ENSMUSP00000141339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036665] [ENSMUST00000193432] [ENSMUST00000195183]
Predicted Effect probably benign
Transcript: ENSMUST00000036665
AA Change: T511A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048603
Gene: ENSMUSG00000027742
AA Change: T511A

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 656 N/A SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192788
Predicted Effect probably benign
Transcript: ENSMUST00000193432
AA Change: T511A

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141339
Gene: ENSMUSG00000027742
AA Change: T511A

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 625 5e-289 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194779
Predicted Effect probably benign
Transcript: ENSMUST00000195183
SMART Domains Protein: ENSMUSP00000141733
Gene: ENSMUSG00000027742

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
Pfam:COG6 39 174 5.5e-32 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The encoded protein is organized with conserved oligomeric Golgi complex components 5, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alg11 T A 8: 22,065,518 I223N probably damaging Het
Ankrd26 G C 6: 118,559,388 probably null Het
Apbb1 T C 7: 105,567,684 D264G probably damaging Het
Arhgap32 T C 9: 32,257,474 Y918H probably benign Het
Astn2 T G 4: 65,911,682 T584P probably damaging Het
Atxn7 G A 14: 14,100,381 S689N probably benign Het
Cacna1h T C 17: 25,387,863 N873S probably damaging Het
Cadps T A 14: 12,488,987 I857F probably damaging Het
Ccdc189 T A 7: 127,586,830 M102L probably benign Het
Dppa3 A T 6: 122,629,332 N118I probably damaging Het
Dst A G 1: 34,195,828 N3663D probably benign Het
Eme1 G A 11: 94,647,992 T354M possibly damaging Het
Gm10735 T C 13: 113,041,209 probably benign Het
Gm2035 A T 12: 87,919,797 S21T unknown Het
Ifi44l A T 3: 151,762,877 C5* probably null Het
Itln1 G A 1: 171,534,807 T2I probably benign Het
Jam2 T A 16: 84,821,292 M309K possibly damaging Het
Kcnk5 C A 14: 20,144,784 C162F probably damaging Het
Metrn A G 17: 25,796,941 probably benign Het
Muc5b T A 7: 141,863,522 Y3402N probably benign Het
Ncoa7 A T 10: 30,698,257 probably null Het
Nxpe4 A G 9: 48,392,822 R70G possibly damaging Het
Olfr1281 T G 2: 111,329,130 L237R probably damaging Het
Olfr134 A C 17: 38,175,881 I266L possibly damaging Het
Olfr373 T C 8: 72,100,344 Y195H probably damaging Het
Olfr670 A T 7: 104,960,594 I46N probably benign Het
Onecut3 T C 10: 80,513,959 I429T probably damaging Het
Pds5a A G 5: 65,629,986 S858P possibly damaging Het
Phf11c A T 14: 59,393,067 V63E probably benign Het
Rasa3 A G 8: 13,570,264 F802L possibly damaging Het
Sec24b G T 3: 130,040,719 Q141K probably benign Het
Sec61a1 A T 6: 88,515,431 probably null Het
Slc45a3 T A 1: 131,981,661 L532Q probably damaging Het
Slc46a2 T C 4: 59,914,048 I292V probably benign Het
Smg1 C T 7: 118,148,733 probably null Het
Spag6 T A 2: 18,715,638 probably null Het
Spi1 T C 2: 91,115,335 F254L probably damaging Het
Sspo T C 6: 48,490,934 S4272P probably benign Het
Tgm5 T C 2: 121,070,735 T292A probably damaging Het
Tmem229a T A 6: 24,954,832 I308F probably damaging Het
Ttn T C 2: 76,724,120 I30784V possibly damaging Het
Urod T A 4: 116,992,683 T173S probably benign Het
Vmn1r223 A T 13: 23,249,415 M60L probably benign Het
Vmn2r2 T A 3: 64,134,491 I268L probably benign Het
Vwa8 C T 14: 79,082,852 T1101M probably benign Het
Zc3h12c T A 9: 52,144,428 probably null Het
Other mutations in Cog6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Cog6 APN 3 52986425 missense probably benign 0.03
IGL01946:Cog6 APN 3 53002404 intron probably benign
IGL02122:Cog6 APN 3 52998342 missense probably benign 0.04
IGL02589:Cog6 APN 3 53007270 missense probably damaging 1.00
IGL02819:Cog6 APN 3 53009545 missense probably damaging 0.98
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0086:Cog6 UTSW 3 52993570 missense probably damaging 0.98
R0545:Cog6 UTSW 3 52996075 missense probably damaging 1.00
R0707:Cog6 UTSW 3 53013862 missense possibly damaging 0.71
R0718:Cog6 UTSW 3 53010629 missense probably benign 0.35
R1169:Cog6 UTSW 3 53013844 missense probably benign 0.30
R1451:Cog6 UTSW 3 53009113 missense possibly damaging 0.78
R1891:Cog6 UTSW 3 52983180 missense probably benign
R2249:Cog6 UTSW 3 53000479 critical splice donor site probably null
R2264:Cog6 UTSW 3 52992911 nonsense probably null
R3745:Cog6 UTSW 3 52992819 missense probably benign 0.05
R4027:Cog6 UTSW 3 53002529 missense possibly damaging 0.95
R4400:Cog6 UTSW 3 53012941 missense probably benign 0.11
R4551:Cog6 UTSW 3 52998320 missense probably damaging 1.00
R4866:Cog6 UTSW 3 53010598 missense probably benign 0.10
R5326:Cog6 UTSW 3 53013816 missense probably null 0.12
R6169:Cog6 UTSW 3 53007301 missense probably benign 0.03
R6273:Cog6 UTSW 3 52996052 missense probably damaging 1.00
R7169:Cog6 UTSW 3 52989966 missense possibly damaging 0.94
R7199:Cog6 UTSW 3 52983189 missense probably benign 0.21
R7243:Cog6 UTSW 3 53002315 missense probably damaging 1.00
R7299:Cog6 UTSW 3 53002507 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGCATCTCTAAAACTGAAAGCC -3'
(R):5'- ACATCCTGGACCATCTCCTG -3'

Sequencing Primer
(F):5'- CTGAAAGCCAAAATTGTGTGTGTG -3'
(R):5'- ATCCTGGACCATCTCCTGATTAGG -3'
Posted On2015-06-12