Incidental Mutation 'R4231:Prkar1b'
ID320840
Institutional Source Beutler Lab
Gene Symbol Prkar1b
Ensembl Gene ENSMUSG00000025855
Gene Nameprotein kinase, cAMP dependent regulatory, type I beta
SynonymsRIbeta
MMRRC Submission 041050-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R4231 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location139017306-139150001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139108621 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 71 (S71P)
Ref Sequence ENSEMBL: ENSMUSP00000116727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026973] [ENSMUST00000110889] [ENSMUST00000110890] [ENSMUST00000129851] [ENSMUST00000134762] [ENSMUST00000141985] [ENSMUST00000147505] [ENSMUST00000148002] [ENSMUST00000155833]
Predicted Effect probably benign
Transcript: ENSMUST00000026973
AA Change: S71P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026973
Gene: ENSMUSG00000025855
AA Change: S71P

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
cNMP 137 253 1.07e-28 SMART
cNMP 255 374 3.95e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110889
SMART Domains Protein: ENSMUSP00000106514
Gene: ENSMUSG00000025855

DomainStartEndE-ValueType
cNMP 13 129 1.07e-28 SMART
cNMP 131 250 3.95e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110890
AA Change: S71P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106515
Gene: ENSMUSG00000025855
AA Change: S71P

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
cNMP 137 253 1.07e-28 SMART
cNMP 255 374 3.95e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129851
AA Change: S71P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000121093
Gene: ENSMUSG00000025855
AA Change: S71P

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
cNMP 137 235 1.24e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134762
AA Change: S71P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116022
Gene: ENSMUSG00000025855
AA Change: S71P

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141985
Predicted Effect probably damaging
Transcript: ENSMUST00000147505
AA Change: S71P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116727
Gene: ENSMUSG00000025855
AA Change: S71P

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148002
AA Change: S71P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000123286
Gene: ENSMUSG00000025855
AA Change: S71P

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
cNMP 137 250 8.27e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155833
AA Change: S71P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122693
Gene: ENSMUSG00000025855
AA Change: S71P

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulatory subunit of cyclic AMP-dependent protein kinase A (PKA), which is involved in the signaling pathway of the second messenger cAMP. Two regulatory and two catalytic subunits form the PKA holoenzyme, disbands after cAMP binding. The holoenzyme is involved in many cellular events, including ion transport, metabolism, and transcription. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have reduced LTD and LTP in specific CNS tracts, but normal neuroanatomy and behavior. Response to pain after inflammation is reduced, concurrent with decreased plasma extravasation during the inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
4932438A13Rik C T 3: 36,920,236 T663I probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 A T 12: 53,141,038 D1745V probably damaging Het
Aldh5a1 C T 13: 24,911,653 G494R probably damaging Het
Ankar T C 1: 72,658,542 D1034G probably benign Het
Aox3 T A 1: 58,114,885 N23K probably benign Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Cacnb2 A G 2: 14,981,440 K343E probably damaging Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cd93 A T 2: 148,442,960 H155Q probably benign Het
Cox6b2 T C 7: 4,752,835 M1V probably null Het
Crat T C 2: 30,413,011 E88G possibly damaging Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dip2a G A 10: 76,319,470 P94S probably damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Fam196b A T 11: 34,403,143 E395V probably benign Het
Filip1l T C 16: 57,506,768 S54P probably benign Het
Gm12887 A T 4: 121,622,102 M1K probably null Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Irak2 A G 6: 113,690,856 E466G probably damaging Het
Irgm2 C T 11: 58,219,478 probably benign Het
Jak3 T A 8: 71,685,545 V880D probably damaging Het
Jmy G T 13: 93,498,925 P128T probably benign Het
Kif20a A G 18: 34,632,038 N775S probably benign Het
Kremen1 G A 11: 5,243,881 Q50* probably null Het
Lrrc71 A G 3: 87,740,991 I438T probably benign Het
Map3k1 T C 13: 111,768,494 T374A probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mta1 T C 12: 113,135,827 M603T possibly damaging Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Nalcn T A 14: 123,599,913 Q13L probably benign Het
Nbas A G 12: 13,393,343 N1133S probably damaging Het
Nsun2 A G 13: 69,619,541 N205D probably damaging Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr1293-ps C T 2: 111,528,201 R314C probably damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A G 1: 97,884,124 probably null Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Plxna2 C T 1: 194,644,454 T232I probably damaging Het
Ptprq A T 10: 107,686,283 Y602* probably null Het
Rfx4 A T 10: 84,814,694 M84L probably benign Het
Rfx7 A T 9: 72,619,390 E1287D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf216 A T 5: 143,093,090 S35T probably damaging Het
Rps6kc1 A G 1: 190,808,900 V402A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sart3 A G 5: 113,771,418 M73T probably benign Het
Scn10a G T 9: 119,631,544 T1088K probably damaging Het
Senp2 T C 16: 22,011,554 probably null Het
Setd7 T C 3: 51,542,730 N92D probably benign Het
Sipa1 A T 19: 5,654,089 L735Q probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slitrk6 A T 14: 110,751,388 S296T probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tex15 T C 8: 33,572,137 S806P probably damaging Het
Tgm3 A T 2: 130,044,589 K577* probably null Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Xpo6 T C 7: 126,174,182 T24A possibly damaging Het
Zfhx2 A G 14: 55,073,534 C568R possibly damaging Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Prkar1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0470:Prkar1b UTSW 5 139050749 missense probably damaging 0.98
R0558:Prkar1b UTSW 5 139020092 missense probably benign 0.04
R1512:Prkar1b UTSW 5 139050673 nonsense probably null
R1982:Prkar1b UTSW 5 139127643 missense probably benign 0.06
R5326:Prkar1b UTSW 5 139127789 splice site probably null
R5350:Prkar1b UTSW 5 139106628 missense probably damaging 1.00
R5693:Prkar1b UTSW 5 139127645 missense possibly damaging 0.65
R7136:Prkar1b UTSW 5 139108608 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGGGTGAACACATGCTGG -3'
(R):5'- TCAGCAGTCTAACAGAACTATGG -3'

Sequencing Primer
(F):5'- GAACACATGCTGGGGCTCTTTAC -3'
(R):5'- ATTCTAGGCAGGGGCTCTACAAC -3'
Posted On2015-06-12