Incidental Mutation 'R4231:Rnf216'
ID320842
Institutional Source Beutler Lab
Gene Symbol Rnf216
Ensembl Gene ENSMUSG00000045078
Gene Namering finger protein 216
Synonyms2810055G22Rik, Ubce7ip1, F830018F18Rik, UIP83
MMRRC Submission 041050-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4231 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location142990893-143112994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143093090 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 35 (S35T)
Ref Sequence ENSEMBL: ENSMUSP00000143242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053498] [ENSMUST00000197296] [ENSMUST00000200430] [ENSMUST00000200607]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053498
AA Change: S35T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052563
Gene: ENSMUSG00000045078
AA Change: S35T

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197296
AA Change: S35T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200002
Predicted Effect probably benign
Transcript: ENSMUST00000200430
Predicted Effect possibly damaging
Transcript: ENSMUST00000200607
AA Change: S35T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143705
Gene: ENSMUSG00000045078
AA Change: S35T

DomainStartEndE-ValueType
Blast:RING 560 620 4e-6 BLAST
IBR 629 693 6.82e-5 SMART
IBR 702 769 1.79e-1 SMART
low complexity region 786 803 N/A INTRINSIC
low complexity region 842 866 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which specifically colocalizes and interacts with the serine/threonine protein kinase, receptor-interacting protein (RIP). Zinc finger domains of the encoded protein are required for its interaction with RIP and for inhibition of TNF- and IL1-induced NF-kappa B activation pathways. The encoded protein may also function as an E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes and transfers it to substrates. Several alternatively spliced transcript variants have been described for this locus but the full-length natures of only some are known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
4932438A13Rik C T 3: 36,920,236 T663I probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 A T 12: 53,141,038 D1745V probably damaging Het
Aldh5a1 C T 13: 24,911,653 G494R probably damaging Het
Ankar T C 1: 72,658,542 D1034G probably benign Het
Aox3 T A 1: 58,114,885 N23K probably benign Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Cacnb2 A G 2: 14,981,440 K343E probably damaging Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cd93 A T 2: 148,442,960 H155Q probably benign Het
Cox6b2 T C 7: 4,752,835 M1V probably null Het
Crat T C 2: 30,413,011 E88G possibly damaging Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dip2a G A 10: 76,319,470 P94S probably damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Fam196b A T 11: 34,403,143 E395V probably benign Het
Filip1l T C 16: 57,506,768 S54P probably benign Het
Gm12887 A T 4: 121,622,102 M1K probably null Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Irak2 A G 6: 113,690,856 E466G probably damaging Het
Irgm2 C T 11: 58,219,478 probably benign Het
Jak3 T A 8: 71,685,545 V880D probably damaging Het
Jmy G T 13: 93,498,925 P128T probably benign Het
Kif20a A G 18: 34,632,038 N775S probably benign Het
Kremen1 G A 11: 5,243,881 Q50* probably null Het
Lrrc71 A G 3: 87,740,991 I438T probably benign Het
Map3k1 T C 13: 111,768,494 T374A probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mta1 T C 12: 113,135,827 M603T possibly damaging Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Nalcn T A 14: 123,599,913 Q13L probably benign Het
Nbas A G 12: 13,393,343 N1133S probably damaging Het
Nsun2 A G 13: 69,619,541 N205D probably damaging Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr1293-ps C T 2: 111,528,201 R314C probably damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A G 1: 97,884,124 probably null Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Plxna2 C T 1: 194,644,454 T232I probably damaging Het
Prkar1b A G 5: 139,108,621 S71P probably damaging Het
Ptprq A T 10: 107,686,283 Y602* probably null Het
Rfx4 A T 10: 84,814,694 M84L probably benign Het
Rfx7 A T 9: 72,619,390 E1287D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rps6kc1 A G 1: 190,808,900 V402A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sart3 A G 5: 113,771,418 M73T probably benign Het
Scn10a G T 9: 119,631,544 T1088K probably damaging Het
Senp2 T C 16: 22,011,554 probably null Het
Setd7 T C 3: 51,542,730 N92D probably benign Het
Sipa1 A T 19: 5,654,089 L735Q probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slitrk6 A T 14: 110,751,388 S296T probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tex15 T C 8: 33,572,137 S806P probably damaging Het
Tgm3 A T 2: 130,044,589 K577* probably null Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Xpo6 T C 7: 126,174,182 T24A possibly damaging Het
Zfhx2 A G 14: 55,073,534 C568R possibly damaging Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Rnf216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Rnf216 APN 5 143068910 missense possibly damaging 0.67
IGL02502:Rnf216 APN 5 143068867 missense probably damaging 1.00
IGL02536:Rnf216 APN 5 143080240 missense probably benign 0.04
IGL03196:Rnf216 APN 5 143081011 missense probably damaging 1.00
PIT4445001:Rnf216 UTSW 5 143086003 missense probably damaging 1.00
R0270:Rnf216 UTSW 5 143080241 missense possibly damaging 0.63
R0422:Rnf216 UTSW 5 143015654 nonsense probably null
R0422:Rnf216 UTSW 5 143090370 missense probably benign 0.15
R0782:Rnf216 UTSW 5 143068892 missense possibly damaging 0.64
R1109:Rnf216 UTSW 5 143068369 missense probably damaging 1.00
R1917:Rnf216 UTSW 5 142992806 missense probably benign 0.03
R2233:Rnf216 UTSW 5 143090926 missense probably benign
R2234:Rnf216 UTSW 5 143090926 missense probably benign
R2235:Rnf216 UTSW 5 143090926 missense probably benign
R2340:Rnf216 UTSW 5 143080334 missense probably damaging 0.99
R3015:Rnf216 UTSW 5 143075725 critical splice donor site probably null
R3726:Rnf216 UTSW 5 143027946 missense probably damaging 0.96
R4885:Rnf216 UTSW 5 143090580 nonsense probably null
R4942:Rnf216 UTSW 5 143093059 missense probably damaging 1.00
R4973:Rnf216 UTSW 5 143090316 missense probably benign
R5291:Rnf216 UTSW 5 143090212 missense probably benign
R5307:Rnf216 UTSW 5 143093002 missense probably damaging 1.00
R5328:Rnf216 UTSW 5 143092999 missense possibly damaging 0.84
R5416:Rnf216 UTSW 5 143015771 nonsense probably null
R5888:Rnf216 UTSW 5 143068314 splice site probably null
R6048:Rnf216 UTSW 5 143068904 missense probably damaging 1.00
R6451:Rnf216 UTSW 5 142992834 missense possibly damaging 0.80
R6595:Rnf216 UTSW 5 143090657 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACCACATAGAGCGTTAAAGC -3'
(R):5'- AGAATCTCAGGCATGCACCC -3'

Sequencing Primer
(F):5'- CGTTAAAGCTAAAACACAAGAGGC -3'
(R):5'- TTCTCCCACCTAACATAAAGAGTTG -3'
Posted On2015-06-12