Incidental Mutation 'R4231:Rfx7'
ID320855
Institutional Source Beutler Lab
Gene Symbol Rfx7
Ensembl Gene ENSMUSG00000037674
Gene Nameregulatory factor X, 7
Synonyms9930116O05Rik, D130086K05Rik, 2510005N23Rik, Rfxdc2
MMRRC Submission 041050-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R4231 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72532240-72622937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72619390 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1287 (E1287D)
Ref Sequence ENSEMBL: ENSMUSP00000127192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093820] [ENSMUST00000163401]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093820
AA Change: E1287D

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091338
Gene: ENSMUSG00000037674
AA Change: E1287D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-11 PDB
Pfam:RFX_DNA_binding 101 185 3.1e-39 PFAM
low complexity region 260 270 N/A INTRINSIC
low complexity region 304 321 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 947 965 N/A INTRINSIC
low complexity region 1010 1018 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
low complexity region 1252 1263 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163401
AA Change: E1287D

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127192
Gene: ENSMUSG00000037674
AA Change: E1287D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
PDB:2KW3|B 41 95 4e-11 PDB
Pfam:RFX_DNA_binding 105 183 2.9e-33 PFAM
low complexity region 260 270 N/A INTRINSIC
low complexity region 304 321 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 947 965 N/A INTRINSIC
low complexity region 1010 1018 N/A INTRINSIC
low complexity region 1066 1081 N/A INTRINSIC
low complexity region 1252 1263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185013
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RFX7 is a member of the regulatory factor X (RFX) family of transcription factors (see RFX1, MIM 600006) (Aftab et al., 2008 [PubMed 18673564]).[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
4932438A13Rik C T 3: 36,920,236 T663I probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 A T 12: 53,141,038 D1745V probably damaging Het
Aldh5a1 C T 13: 24,911,653 G494R probably damaging Het
Ankar T C 1: 72,658,542 D1034G probably benign Het
Aox3 T A 1: 58,114,885 N23K probably benign Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Cacnb2 A G 2: 14,981,440 K343E probably damaging Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cd93 A T 2: 148,442,960 H155Q probably benign Het
Cox6b2 T C 7: 4,752,835 M1V probably null Het
Crat T C 2: 30,413,011 E88G possibly damaging Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dip2a G A 10: 76,319,470 P94S probably damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Fam196b A T 11: 34,403,143 E395V probably benign Het
Filip1l T C 16: 57,506,768 S54P probably benign Het
Gm12887 A T 4: 121,622,102 M1K probably null Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Irak2 A G 6: 113,690,856 E466G probably damaging Het
Irgm2 C T 11: 58,219,478 probably benign Het
Jak3 T A 8: 71,685,545 V880D probably damaging Het
Jmy G T 13: 93,498,925 P128T probably benign Het
Kif20a A G 18: 34,632,038 N775S probably benign Het
Kremen1 G A 11: 5,243,881 Q50* probably null Het
Lrrc71 A G 3: 87,740,991 I438T probably benign Het
Map3k1 T C 13: 111,768,494 T374A probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mta1 T C 12: 113,135,827 M603T possibly damaging Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Nalcn T A 14: 123,599,913 Q13L probably benign Het
Nbas A G 12: 13,393,343 N1133S probably damaging Het
Nsun2 A G 13: 69,619,541 N205D probably damaging Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr1293-ps C T 2: 111,528,201 R314C probably damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A G 1: 97,884,124 probably null Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Plxna2 C T 1: 194,644,454 T232I probably damaging Het
Prkar1b A G 5: 139,108,621 S71P probably damaging Het
Ptprq A T 10: 107,686,283 Y602* probably null Het
Rfx4 A T 10: 84,814,694 M84L probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf216 A T 5: 143,093,090 S35T probably damaging Het
Rps6kc1 A G 1: 190,808,900 V402A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sart3 A G 5: 113,771,418 M73T probably benign Het
Scn10a G T 9: 119,631,544 T1088K probably damaging Het
Senp2 T C 16: 22,011,554 probably null Het
Setd7 T C 3: 51,542,730 N92D probably benign Het
Sipa1 A T 19: 5,654,089 L735Q probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slitrk6 A T 14: 110,751,388 S296T probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tex15 T C 8: 33,572,137 S806P probably damaging Het
Tgm3 A T 2: 130,044,589 K577* probably null Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Xpo6 T C 7: 126,174,182 T24A possibly damaging Het
Zfhx2 A G 14: 55,073,534 C568R possibly damaging Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Rfx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Rfx7 APN 9 72607690 missense probably damaging 1.00
IGL00323:Rfx7 APN 9 72617420 missense probably damaging 0.97
IGL00920:Rfx7 APN 9 72593356 missense probably damaging 1.00
IGL01317:Rfx7 APN 9 72618536 missense probably damaging 0.98
IGL01405:Rfx7 APN 9 72610344 missense probably benign 0.02
IGL01585:Rfx7 APN 9 72617061 missense probably benign 0.41
IGL02118:Rfx7 APN 9 72617204 missense probably benign
IGL02205:Rfx7 APN 9 72607650 missense probably damaging 1.00
IGL02608:Rfx7 APN 9 72617294 missense probably benign 0.00
IGL02629:Rfx7 APN 9 72619259 missense probably damaging 0.96
IGL02963:Rfx7 APN 9 72617616 missense probably benign 0.00
IGL03026:Rfx7 APN 9 72619685 missense probably damaging 1.00
IGL03033:Rfx7 APN 9 72532989 splice site probably benign
IGL03212:Rfx7 APN 9 72619161 missense probably benign 0.06
IGL03221:Rfx7 APN 9 72618806 missense probably damaging 0.99
PIT4431001:Rfx7 UTSW 9 72617971 missense probably benign
R0365:Rfx7 UTSW 9 72619836 missense probably benign 0.15
R0449:Rfx7 UTSW 9 72610304 critical splice acceptor site probably null
R0464:Rfx7 UTSW 9 72618204 missense probably damaging 1.00
R0746:Rfx7 UTSW 9 72619106 missense probably benign 0.00
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1195:Rfx7 UTSW 9 72617946 missense probably damaging 0.99
R1263:Rfx7 UTSW 9 72577047 missense possibly damaging 0.79
R1277:Rfx7 UTSW 9 72593312 missense probably benign 0.32
R1330:Rfx7 UTSW 9 72617265 missense probably benign 0.00
R1371:Rfx7 UTSW 9 72619575 missense probably damaging 1.00
R1605:Rfx7 UTSW 9 72611789 missense probably damaging 1.00
R1802:Rfx7 UTSW 9 72619637 missense possibly damaging 0.50
R1903:Rfx7 UTSW 9 72616811 missense probably damaging 1.00
R2018:Rfx7 UTSW 9 72617685 missense probably benign 0.01
R2050:Rfx7 UTSW 9 72617466 missense probably benign 0.01
R2190:Rfx7 UTSW 9 72617919 missense probably benign 0.00
R2208:Rfx7 UTSW 9 72617964 missense probably benign 0.00
R2921:Rfx7 UTSW 9 72617664 missense possibly damaging 0.63
R3978:Rfx7 UTSW 9 72615111 missense possibly damaging 0.80
R4243:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4244:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4245:Rfx7 UTSW 9 72591769 missense possibly damaging 0.94
R4261:Rfx7 UTSW 9 72616643 missense probably damaging 1.00
R4844:Rfx7 UTSW 9 72593242 nonsense probably null
R4902:Rfx7 UTSW 9 72617291 missense probably benign 0.05
R5432:Rfx7 UTSW 9 72593302 missense probably benign 0.35
R5627:Rfx7 UTSW 9 72532784 start gained probably benign
R5900:Rfx7 UTSW 9 72617256 missense probably benign
R5991:Rfx7 UTSW 9 72619538 missense possibly damaging 0.54
R6273:Rfx7 UTSW 9 72616997 missense possibly damaging 0.47
R6306:Rfx7 UTSW 9 72616955 missense possibly damaging 0.63
R6324:Rfx7 UTSW 9 72618414 missense probably damaging 1.00
R6437:Rfx7 UTSW 9 72618486 missense possibly damaging 0.66
R6860:Rfx7 UTSW 9 72616944 missense probably damaging 1.00
R6998:Rfx7 UTSW 9 72618505 missense probably damaging 1.00
R7255:Rfx7 UTSW 9 72619828 missense possibly damaging 0.77
R7336:Rfx7 UTSW 9 72593357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCCATTGACAGTCATGATGC -3'
(R):5'- GCAGGTTGTCTCCACTCAAC -3'

Sequencing Primer
(F):5'- TTGACAGTCATGATGCAAACAGC -3'
(R):5'- CTCAACAGGTCTTTAACAGTGC -3'
Posted On2015-06-12