Incidental Mutation 'R4231:Ip6k2'
ID320858
Institutional Source Beutler Lab
Gene Symbol Ip6k2
Ensembl Gene ENSMUSG00000032599
Gene Nameinositol hexaphosphate kinase 2
SynonymsIhpk2, 1500005N04Rik
MMRRC Submission 041050-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4231 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108783796-108806337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108805648 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 319 (R319Q)
Ref Sequence ENSEMBL: ENSMUSP00000082091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000085018] [ENSMUST00000193560] [ENSMUST00000194819] [ENSMUST00000195323]
Predicted Effect probably benign
Transcript: ENSMUST00000035218
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085018
AA Change: R319Q

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000082091
Gene: ENSMUSG00000032599
AA Change: R319Q

DomainStartEndE-ValueType
Pfam:IPK 225 440 2.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193560
AA Change: R273Q

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141605
Gene: ENSMUSG00000032599
AA Change: R273Q

DomainStartEndE-ValueType
Pfam:IPK 179 394 1.6e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4 and affect the growth suppressive and apoptotic activities of interferon-beta in some ovarian cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are resistant to radiation-induced mortality and show increased double-strand DNA break repair and incidence of induced aerodigestive tract carcinomas. Homozygotes for another null allele show increased B cell viability after radiation or neocarzinostatin treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
4932438A13Rik C T 3: 36,920,236 T663I probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 A T 12: 53,141,038 D1745V probably damaging Het
Aldh5a1 C T 13: 24,911,653 G494R probably damaging Het
Ankar T C 1: 72,658,542 D1034G probably benign Het
Aox3 T A 1: 58,114,885 N23K probably benign Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Cacnb2 A G 2: 14,981,440 K343E probably damaging Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cd93 A T 2: 148,442,960 H155Q probably benign Het
Cox6b2 T C 7: 4,752,835 M1V probably null Het
Crat T C 2: 30,413,011 E88G possibly damaging Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dip2a G A 10: 76,319,470 P94S probably damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Fam196b A T 11: 34,403,143 E395V probably benign Het
Filip1l T C 16: 57,506,768 S54P probably benign Het
Gm12887 A T 4: 121,622,102 M1K probably null Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Irak2 A G 6: 113,690,856 E466G probably damaging Het
Irgm2 C T 11: 58,219,478 probably benign Het
Jak3 T A 8: 71,685,545 V880D probably damaging Het
Jmy G T 13: 93,498,925 P128T probably benign Het
Kif20a A G 18: 34,632,038 N775S probably benign Het
Kremen1 G A 11: 5,243,881 Q50* probably null Het
Lrrc71 A G 3: 87,740,991 I438T probably benign Het
Map3k1 T C 13: 111,768,494 T374A probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mta1 T C 12: 113,135,827 M603T possibly damaging Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Nalcn T A 14: 123,599,913 Q13L probably benign Het
Nbas A G 12: 13,393,343 N1133S probably damaging Het
Nsun2 A G 13: 69,619,541 N205D probably damaging Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr1293-ps C T 2: 111,528,201 R314C probably damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A G 1: 97,884,124 probably null Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Plxna2 C T 1: 194,644,454 T232I probably damaging Het
Prkar1b A G 5: 139,108,621 S71P probably damaging Het
Ptprq A T 10: 107,686,283 Y602* probably null Het
Rfx4 A T 10: 84,814,694 M84L probably benign Het
Rfx7 A T 9: 72,619,390 E1287D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf216 A T 5: 143,093,090 S35T probably damaging Het
Rps6kc1 A G 1: 190,808,900 V402A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sart3 A G 5: 113,771,418 M73T probably benign Het
Scn10a G T 9: 119,631,544 T1088K probably damaging Het
Senp2 T C 16: 22,011,554 probably null Het
Setd7 T C 3: 51,542,730 N92D probably benign Het
Sipa1 A T 19: 5,654,089 L735Q probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slitrk6 A T 14: 110,751,388 S296T probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tex15 T C 8: 33,572,137 S806P probably damaging Het
Tgm3 A T 2: 130,044,589 K577* probably null Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Xpo6 T C 7: 126,174,182 T24A possibly damaging Het
Zfhx2 A G 14: 55,073,534 C568R possibly damaging Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Ip6k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ip6k2 APN 9 108805744 missense probably damaging 1.00
IGL01585:Ip6k2 APN 9 108796313 missense probably damaging 1.00
IGL02377:Ip6k2 APN 9 108804599 missense probably damaging 1.00
IGL02831:Ip6k2 APN 9 108804534 unclassified probably benign
banting UTSW 9 108805648 missense probably benign 0.07
R0310:Ip6k2 UTSW 9 108799233 splice site probably benign
R0541:Ip6k2 UTSW 9 108804627 missense probably damaging 1.00
R2378:Ip6k2 UTSW 9 108796301 unclassified probably null
R4119:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4120:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4165:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4232:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4235:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4236:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4327:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4328:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R5019:Ip6k2 UTSW 9 108797746 intron probably benign
R5466:Ip6k2 UTSW 9 108798462 missense probably damaging 1.00
R6017:Ip6k2 UTSW 9 108797267 missense probably benign 0.01
R6688:Ip6k2 UTSW 9 108806011 missense probably benign 0.00
R6971:Ip6k2 UTSW 9 108797311 intron probably benign
R7150:Ip6k2 UTSW 9 108796731 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTACAGTGACTGAACCTAGGTG -3'
(R):5'- CTCCAAGTCCTCAGCATCTG -3'

Sequencing Primer
(F):5'- TGAACCTAGGTGATGGGACCTACTC -3'
(R):5'- ATCTGAGTCCAGGGTCACTTCTG -3'
Posted On2015-06-12