Incidental Mutation 'R4231:Dtx3'
ID320863
Institutional Source Beutler Lab
Gene Symbol Dtx3
Ensembl Gene ENSMUSG00000040415
Gene Namedeltex 3, E3 ubiquitin ligase
Synonyms
MMRRC Submission 041050-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R4231 (G1)
Quality Score221
Status Validated
Chromosome10
Chromosomal Location127190378-127195728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127193189 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 60 (I60T)
Ref Sequence ENSEMBL: ENSMUSP00000116510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013970] [ENSMUST00000019611] [ENSMUST00000038217] [ENSMUST00000116229] [ENSMUST00000130855] [ENSMUST00000137151] [ENSMUST00000144322] [ENSMUST00000167353] [ENSMUST00000218587] [ENSMUST00000218654] [ENSMUST00000219245] [ENSMUST00000222006]
Predicted Effect probably benign
Transcript: ENSMUST00000013970
SMART Domains Protein: ENSMUSP00000013970
Gene: ENSMUSG00000025417

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
PIPKc 72 420 2.3e-172 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019611
SMART Domains Protein: ENSMUSP00000019611
Gene: ENSMUSG00000019467

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 146 171 N/A INTRINSIC
RhoGEF 203 374 2.45e-49 SMART
PH 394 507 6.67e-1 SMART
low complexity region 561 569 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000038217
AA Change: I57T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044627
Gene: ENSMUSG00000040415
AA Change: I57T

DomainStartEndE-ValueType
low complexity region 64 72 N/A INTRINSIC
coiled coil region 73 104 N/A INTRINSIC
low complexity region 119 154 N/A INTRINSIC
RING 164 202 1.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116229
AA Change: I57T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111937
Gene: ENSMUSG00000040415
AA Change: I57T

DomainStartEndE-ValueType
low complexity region 64 72 N/A INTRINSIC
coiled coil region 73 104 N/A INTRINSIC
low complexity region 119 154 N/A INTRINSIC
RING 164 202 1.04e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125254
Predicted Effect possibly damaging
Transcript: ENSMUST00000130855
AA Change: I60T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114776
Gene: ENSMUSG00000040415
AA Change: I60T

DomainStartEndE-ValueType
low complexity region 67 75 N/A INTRINSIC
coiled coil region 76 107 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
RING 167 205 1.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137151
Predicted Effect possibly damaging
Transcript: ENSMUST00000144322
AA Change: I60T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116510
Gene: ENSMUSG00000040415
AA Change: I60T

DomainStartEndE-ValueType
low complexity region 67 75 N/A INTRINSIC
coiled coil region 76 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167353
SMART Domains Protein: ENSMUSP00000126339
Gene: ENSMUSG00000019467

DomainStartEndE-ValueType
low complexity region 72 94 N/A INTRINSIC
low complexity region 137 162 N/A INTRINSIC
RhoGEF 194 365 2.45e-49 SMART
PH 385 498 6.67e-1 SMART
low complexity region 552 560 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218478
Predicted Effect probably benign
Transcript: ENSMUST00000218587
Predicted Effect probably benign
Transcript: ENSMUST00000218654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219079
Predicted Effect probably benign
Transcript: ENSMUST00000219245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219649
Predicted Effect probably benign
Transcript: ENSMUST00000222006
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX3 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
4932438A13Rik C T 3: 36,920,236 T663I probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 A T 12: 53,141,038 D1745V probably damaging Het
Aldh5a1 C T 13: 24,911,653 G494R probably damaging Het
Ankar T C 1: 72,658,542 D1034G probably benign Het
Aox3 T A 1: 58,114,885 N23K probably benign Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Cacnb2 A G 2: 14,981,440 K343E probably damaging Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cd93 A T 2: 148,442,960 H155Q probably benign Het
Cox6b2 T C 7: 4,752,835 M1V probably null Het
Crat T C 2: 30,413,011 E88G possibly damaging Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dip2a G A 10: 76,319,470 P94S probably damaging Het
Fam196b A T 11: 34,403,143 E395V probably benign Het
Filip1l T C 16: 57,506,768 S54P probably benign Het
Gm12887 A T 4: 121,622,102 M1K probably null Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Irak2 A G 6: 113,690,856 E466G probably damaging Het
Irgm2 C T 11: 58,219,478 probably benign Het
Jak3 T A 8: 71,685,545 V880D probably damaging Het
Jmy G T 13: 93,498,925 P128T probably benign Het
Kif20a A G 18: 34,632,038 N775S probably benign Het
Kremen1 G A 11: 5,243,881 Q50* probably null Het
Lrrc71 A G 3: 87,740,991 I438T probably benign Het
Map3k1 T C 13: 111,768,494 T374A probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mta1 T C 12: 113,135,827 M603T possibly damaging Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Nalcn T A 14: 123,599,913 Q13L probably benign Het
Nbas A G 12: 13,393,343 N1133S probably damaging Het
Nsun2 A G 13: 69,619,541 N205D probably damaging Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr1293-ps C T 2: 111,528,201 R314C probably damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A G 1: 97,884,124 probably null Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Plxna2 C T 1: 194,644,454 T232I probably damaging Het
Prkar1b A G 5: 139,108,621 S71P probably damaging Het
Ptprq A T 10: 107,686,283 Y602* probably null Het
Rfx4 A T 10: 84,814,694 M84L probably benign Het
Rfx7 A T 9: 72,619,390 E1287D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf216 A T 5: 143,093,090 S35T probably damaging Het
Rps6kc1 A G 1: 190,808,900 V402A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sart3 A G 5: 113,771,418 M73T probably benign Het
Scn10a G T 9: 119,631,544 T1088K probably damaging Het
Senp2 T C 16: 22,011,554 probably null Het
Setd7 T C 3: 51,542,730 N92D probably benign Het
Sipa1 A T 19: 5,654,089 L735Q probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slitrk6 A T 14: 110,751,388 S296T probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tex15 T C 8: 33,572,137 S806P probably damaging Het
Tgm3 A T 2: 130,044,589 K577* probably null Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Xpo6 T C 7: 126,174,182 T24A possibly damaging Het
Zfhx2 A G 14: 55,073,534 C568R possibly damaging Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Dtx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Dtx3 APN 10 127193279 missense probably damaging 0.99
IGL02314:Dtx3 APN 10 127190959 unclassified probably benign
R0257:Dtx3 UTSW 10 127192892 missense probably benign
R1108:Dtx3 UTSW 10 127191289 missense possibly damaging 0.84
R1422:Dtx3 UTSW 10 127191289 missense possibly damaging 0.84
R3693:Dtx3 UTSW 10 127191424 missense probably benign 0.33
R4016:Dtx3 UTSW 10 127191171 missense probably benign 0.00
R4232:Dtx3 UTSW 10 127193189 missense possibly damaging 0.92
R4236:Dtx3 UTSW 10 127193189 missense possibly damaging 0.92
R4590:Dtx3 UTSW 10 127192695 missense probably damaging 0.99
R4838:Dtx3 UTSW 10 127191307 unclassified probably null
R5338:Dtx3 UTSW 10 127193050 missense probably benign 0.23
R5510:Dtx3 UTSW 10 127192938 missense probably benign 0.08
R6989:Dtx3 UTSW 10 127192877 missense probably benign 0.01
R7225:Dtx3 UTSW 10 127191489 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAATGGGGCAGGTGGTTTC -3'
(R):5'- CATTTATCTGTCAAATGGGGACTCC -3'

Sequencing Primer
(F):5'- TCCTCTCTGAGACGAGGAGG -3'
(R):5'- GAGTCCCTTTCACCCTGGG -3'
Posted On2015-06-12