Incidental Mutation 'R0396:H2-Bl'
ID32088
Institutional Source Beutler Lab
Gene Symbol H2-Bl
Ensembl Gene ENSMUSG00000073406
Gene Namehistocompatibility 2, blastocyst
Synonymsblastocyst MHC
MMRRC Submission 038602-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0396 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36080115-36084223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36083722 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 103 (I103T)
Ref Sequence ENSEMBL: ENSMUSP00000141809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173080] [ENSMUST00000183560] [ENSMUST00000183999] [ENSMUST00000184502] [ENSMUST00000185087] [ENSMUST00000185167] [ENSMUST00000192532] [ENSMUST00000194244] [ENSMUST00000195833] [ENSMUST00000195838]
Predicted Effect probably benign
Transcript: ENSMUST00000173080
AA Change: I103T

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134155
Gene: ENSMUSG00000073406
AA Change: I103T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.6e-88 PFAM
IGc1 219 289 6.29e-19 SMART
transmembrane domain 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174067
AA Change: I103T

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133982
Gene: ENSMUSG00000073406
AA Change: I103T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 6.3e-87 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183560
SMART Domains Protein: ENSMUSP00000138812
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 32 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183999
SMART Domains Protein: ENSMUSP00000139165
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
SCOP:d1dr9a2 21 36 4e-5 SMART
transmembrane domain 46 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184502
AA Change: I103T

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139275
Gene: ENSMUSG00000073406
AA Change: I103T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 6.8e-89 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184850
Predicted Effect probably benign
Transcript: ENSMUST00000185087
AA Change: I103T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139166
Gene: ENSMUSG00000073406
AA Change: I103T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 113 5.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185167
SMART Domains Protein: ENSMUSP00000139373
Gene: ENSMUSG00000073406

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192532
AA Change: I93T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142113
Gene: ENSMUSG00000073406
AA Change: I93T

DomainStartEndE-ValueType
Pfam:MHC_I 12 190 1.4e-88 PFAM
IGc1 209 279 6.29e-19 SMART
transmembrane domain 295 317 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000194244
AA Change: I103T

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141809
Gene: ENSMUSG00000073406
AA Change: I103T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 118 2.9e-43 PFAM
IGc1 127 197 6.29e-19 SMART
transmembrane domain 213 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195833
AA Change: I92T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000141271
Gene: ENSMUSG00000073406
AA Change: I92T

DomainStartEndE-ValueType
Pfam:MHC_I 12 107 1.8e-37 PFAM
IGc1 116 186 6.29e-19 SMART
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195838
AA Change: I92T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141253
Gene: ENSMUSG00000073406
AA Change: I92T

DomainStartEndE-ValueType
Pfam:MHC_I 12 189 1e-82 PFAM
IGc1 208 278 6.29e-19 SMART
transmembrane domain 294 316 N/A INTRINSIC
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,268,377 V467A possibly damaging Het
4933405L10Rik G A 8: 105,709,780 V194I probably benign Het
Acsm1 A T 7: 119,636,455 I133F probably damaging Het
Adamts9 T A 6: 92,798,005 T1676S probably benign Het
Adcy4 T C 14: 55,772,288 D769G probably benign Het
Aif1 T C 17: 35,171,109 *148W probably null Het
Akna C T 4: 63,392,126 probably benign Het
Arhgap32 G A 9: 32,245,255 probably null Het
Atpaf1 G A 4: 115,785,252 E92K possibly damaging Het
C1s1 T C 6: 124,533,354 E378G probably benign Het
Caprin1 T A 2: 103,769,569 Q108L probably damaging Het
Car13 A T 3: 14,656,239 H154L probably benign Het
Cdon C A 9: 35,470,130 N605K probably damaging Het
Ceacam10 G A 7: 24,781,014 G70E probably damaging Het
Cfap221 G A 1: 119,954,200 T286M probably benign Het
Cfap61 T C 2: 145,949,944 F107S possibly damaging Het
Coil C A 11: 88,981,623 T270N probably benign Het
Crocc2 T G 1: 93,224,214 probably benign Het
Crot T C 5: 8,969,959 E461G probably damaging Het
D130052B06Rik G T 11: 33,623,391 R41L unknown Het
D630045J12Rik T C 6: 38,196,736 S166G possibly damaging Het
Dennd4a T G 9: 64,862,391 V460G probably damaging Het
Depdc7 A T 2: 104,727,323 probably benign Het
Dgkb G A 12: 38,190,135 probably null Het
Dhx57 T G 17: 80,274,797 S407R probably benign Het
Dnase2a G T 8: 84,909,763 probably benign Het
Dqx1 T G 6: 83,059,005 M106R probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Ephx2 T G 14: 66,108,063 I151L probably benign Het
Gdf3 C T 6: 122,607,135 G91D probably damaging Het
Gm14124 G A 2: 150,268,053 G221D probably damaging Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gsdme T A 6: 50,221,107 H291L probably benign Het
Hif3a G A 7: 17,052,021 probably benign Het
Hmox2 A T 16: 4,765,763 I232L probably benign Het
Itgb2 A G 10: 77,561,189 Y686C probably damaging Het
Jmjd1c A G 10: 67,219,523 T528A possibly damaging Het
Kdr T C 5: 75,960,728 I541V possibly damaging Het
Khdrbs2 C A 1: 32,519,973 V343L probably damaging Het
Kif16b C T 2: 142,853,659 R175H probably damaging Het
Klri2 T G 6: 129,740,288 E44A possibly damaging Het
Kmt2b G T 7: 30,576,755 T1773K probably damaging Het
Lair1 A G 7: 4,010,786 L154P probably damaging Het
Larp1b G A 3: 40,970,561 V158M probably damaging Het
Lgi3 T A 14: 70,534,840 I275N probably damaging Het
Lrba A G 3: 86,295,179 N246D probably damaging Het
Lrrc45 T A 11: 120,714,907 probably benign Het
Mdh2 G T 5: 135,789,679 V263L probably benign Het
Myom1 T A 17: 71,034,693 V149E probably damaging Het
Nanos1 A T 19: 60,757,041 D259V probably damaging Het
Nedd4l T A 18: 65,161,654 probably benign Het
Npas3 A G 12: 53,831,745 Y150C probably damaging Het
Olfr1066 T C 2: 86,456,019 N84S possibly damaging Het
Olfr1129 T A 2: 87,575,567 V161D possibly damaging Het
Olfr1392 A T 11: 49,293,338 I6F probably benign Het
Olfr479 A T 7: 108,055,963 H327L probably benign Het
Olfr672 G A 7: 104,996,706 A66V probably damaging Het
Olfr93 C T 17: 37,151,555 C139Y probably damaging Het
Pde4c A G 8: 70,750,076 N637S probably benign Het
Pds5b T A 5: 150,779,275 V824D possibly damaging Het
Pole2 A T 12: 69,222,386 probably benign Het
Ppig C T 2: 69,735,976 probably benign Het
Prep A G 10: 45,092,676 Y90C probably damaging Het
Proca1 A T 11: 78,194,905 R11S probably damaging Het
Prph T A 15: 99,056,991 W313R probably benign Het
Prune2 C T 19: 17,123,080 P1983S probably benign Het
Ptbp2 G A 3: 119,724,198 probably benign Het
Rsph6a C T 7: 19,074,106 P398L probably damaging Het
Sdk2 T C 11: 113,829,967 I1379V probably benign Het
Sf3b1 C T 1: 55,019,271 G53E probably damaging Het
Slc9a3 T C 13: 74,157,784 probably null Het
Smarcal1 A T 1: 72,626,473 H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,150,707 probably benign Het
Sptan1 T C 2: 29,991,033 V438A probably damaging Het
Sstr4 T A 2: 148,396,261 V264D probably damaging Het
Susd2 A G 10: 75,639,911 L418P probably damaging Het
Synj1 A G 16: 90,938,640 V1475A probably benign Het
Szt2 G A 4: 118,376,347 probably benign Het
Tbc1d4 T C 14: 101,458,063 probably null Het
Tesk1 A G 4: 43,446,000 E311G probably damaging Het
Tmed5 A T 5: 108,126,016 V119E probably damaging Het
Tmem260 T C 14: 48,486,867 S201P possibly damaging Het
Tnxb A G 17: 34,671,733 Y350C probably damaging Het
Tpte T C 8: 22,335,608 probably benign Het
Trim37 A T 11: 87,146,968 D161V probably damaging Het
Trrap C A 5: 144,814,556 Q1640K probably damaging Het
Tspoap1 T C 11: 87,776,346 probably benign Het
Ttk T A 9: 83,847,260 probably benign Het
Vmn1r172 A G 7: 23,660,532 S281G probably benign Het
Vmn1r177 A G 7: 23,865,597 S285P probably damaging Het
Vmn1r231 C T 17: 20,890,399 V85I probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r118 T C 17: 55,608,643 I436V probably benign Het
Vmn2r12 T C 5: 109,092,899 K116R probably benign Het
Vmn2r28 T A 7: 5,488,514 I245L probably benign Het
Wdr26 A T 1: 181,180,651 probably benign Het
Xrcc3 A T 12: 111,809,957 H67Q probably benign Het
Zbbx A T 3: 75,078,495 S417T possibly damaging Het
Zc3h13 A G 14: 75,323,482 D504G unknown Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zyg11b A T 4: 108,255,308 F388I probably damaging Het
Other mutations in H2-Bl
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0412:H2-Bl UTSW 17 36081521 splice site probably benign
R0924:H2-Bl UTSW 17 36083932 missense probably damaging 1.00
R1170:H2-Bl UTSW 17 36081091 missense possibly damaging 0.66
R1211:H2-Bl UTSW 17 36081073 missense probably damaging 1.00
R1902:H2-Bl UTSW 17 36083953 missense probably damaging 1.00
R1913:H2-Bl UTSW 17 36081016 missense probably damaging 0.99
R1992:H2-Bl UTSW 17 36081046 missense probably damaging 0.98
R5538:H2-Bl UTSW 17 36081286 missense probably benign 0.35
R6021:H2-Bl UTSW 17 36081274 missense probably damaging 1.00
R7091:H2-Bl UTSW 17 36083941 missense possibly damaging 0.94
R7200:H2-Bl UTSW 17 36081046 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ATCGCGGCCATCATAAGCGAAC -3'
(R):5'- GGCCCACACTCGATGCGATATTTC -3'

Sequencing Primer
(F):5'- GATCCCACGGTCAgccc -3'
(R):5'- TTCGAGACCGCAGTGTTC -3'
Posted On2013-04-24