Incidental Mutation 'R4231:Senp2'
ID320881
Institutional Source Beutler Lab
Gene Symbol Senp2
Ensembl Gene ENSMUSG00000022855
Gene NameSUMO/sentrin specific peptidase 2
Synonyms4930538C18Rik, 2310007L05Rik
MMRRC Submission 041050-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4231 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location22009484-22049269 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 22011554 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023561] [ENSMUST00000231632] [ENSMUST00000231724] [ENSMUST00000232534] [ENSMUST00000232679]
Predicted Effect probably null
Transcript: ENSMUST00000023561
SMART Domains Protein: ENSMUSP00000023561
Gene: ENSMUSG00000022855

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 101 118 N/A INTRINSIC
low complexity region 325 340 N/A INTRINSIC
Pfam:Peptidase_C48 408 587 1.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231408
Predicted Effect probably benign
Transcript: ENSMUST00000231632
Predicted Effect silent
Transcript: ENSMUST00000231724
Predicted Effect probably benign
Transcript: ENSMUST00000231798
Predicted Effect probably null
Transcript: ENSMUST00000232534
Predicted Effect probably benign
Transcript: ENSMUST00000232679
Meta Mutation Damage Score 0.586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SUMO1 (UBL1; MIM 601912) is a small ubiquitin-like protein that can be covalently conjugated to other proteins. SENP2 is one of a group of enzymes that process newly synthesized SUMO1 into the conjugatable form and catalyze the deconjugation of SUMO1-containing species.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygous null mice are embryonic lethal due to placental defects resulting from abnormal trophoblast maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
4932438A13Rik C T 3: 36,920,236 T663I probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 A T 12: 53,141,038 D1745V probably damaging Het
Aldh5a1 C T 13: 24,911,653 G494R probably damaging Het
Ankar T C 1: 72,658,542 D1034G probably benign Het
Aox3 T A 1: 58,114,885 N23K probably benign Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Cacnb2 A G 2: 14,981,440 K343E probably damaging Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cd93 A T 2: 148,442,960 H155Q probably benign Het
Cox6b2 T C 7: 4,752,835 M1V probably null Het
Crat T C 2: 30,413,011 E88G possibly damaging Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dip2a G A 10: 76,319,470 P94S probably damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Fam196b A T 11: 34,403,143 E395V probably benign Het
Filip1l T C 16: 57,506,768 S54P probably benign Het
Gm12887 A T 4: 121,622,102 M1K probably null Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Irak2 A G 6: 113,690,856 E466G probably damaging Het
Irgm2 C T 11: 58,219,478 probably benign Het
Jak3 T A 8: 71,685,545 V880D probably damaging Het
Jmy G T 13: 93,498,925 P128T probably benign Het
Kif20a A G 18: 34,632,038 N775S probably benign Het
Kremen1 G A 11: 5,243,881 Q50* probably null Het
Lrrc71 A G 3: 87,740,991 I438T probably benign Het
Map3k1 T C 13: 111,768,494 T374A probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Mta1 T C 12: 113,135,827 M603T possibly damaging Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Nalcn T A 14: 123,599,913 Q13L probably benign Het
Nbas A G 12: 13,393,343 N1133S probably damaging Het
Nsun2 A G 13: 69,619,541 N205D probably damaging Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr1293-ps C T 2: 111,528,201 R314C probably damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A G 1: 97,884,124 probably null Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Plxna2 C T 1: 194,644,454 T232I probably damaging Het
Prkar1b A G 5: 139,108,621 S71P probably damaging Het
Ptprq A T 10: 107,686,283 Y602* probably null Het
Rfx4 A T 10: 84,814,694 M84L probably benign Het
Rfx7 A T 9: 72,619,390 E1287D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf216 A T 5: 143,093,090 S35T probably damaging Het
Rps6kc1 A G 1: 190,808,900 V402A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sart3 A G 5: 113,771,418 M73T probably benign Het
Scn10a G T 9: 119,631,544 T1088K probably damaging Het
Setd7 T C 3: 51,542,730 N92D probably benign Het
Sipa1 A T 19: 5,654,089 L735Q probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slitrk6 A T 14: 110,751,388 S296T probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tex15 T C 8: 33,572,137 S806P probably damaging Het
Tgm3 A T 2: 130,044,589 K577* probably null Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Xpo6 T C 7: 126,174,182 T24A possibly damaging Het
Zfhx2 A G 14: 55,073,534 C568R possibly damaging Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Senp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Senp2 APN 16 22018364 missense probably damaging 1.00
IGL01562:Senp2 APN 16 22009687 missense probably damaging 1.00
IGL01757:Senp2 APN 16 22009664 missense probably benign 0.13
IGL02593:Senp2 APN 16 22044271 missense probably damaging 1.00
IGL02896:Senp2 APN 16 22018368 nonsense probably null
IGL03219:Senp2 APN 16 22014264 splice site probably benign
IGL03244:Senp2 APN 16 22040579 missense probably damaging 0.97
PIT1430001:Senp2 UTSW 16 22014114 splice site probably benign
R0410:Senp2 UTSW 16 22009694 missense probably damaging 0.99
R0511:Senp2 UTSW 16 22036570 missense probably benign 0.01
R1186:Senp2 UTSW 16 22011504 missense probably damaging 0.99
R1689:Senp2 UTSW 16 22026666 missense probably damaging 0.98
R1723:Senp2 UTSW 16 22028042 missense probably benign 0.00
R1776:Senp2 UTSW 16 22043060 splice site probably benign
R2056:Senp2 UTSW 16 22014199 missense probably damaging 1.00
R2058:Senp2 UTSW 16 22014199 missense probably damaging 1.00
R2371:Senp2 UTSW 16 22018375 missense possibly damaging 0.86
R3838:Senp2 UTSW 16 22009735 missense probably damaging 0.99
R3839:Senp2 UTSW 16 22009735 missense probably damaging 0.99
R4001:Senp2 UTSW 16 22028568 missense possibly damaging 0.95
R4190:Senp2 UTSW 16 22046667 missense probably damaging 1.00
R4191:Senp2 UTSW 16 22046667 missense probably damaging 1.00
R4193:Senp2 UTSW 16 22046667 missense probably damaging 1.00
R4435:Senp2 UTSW 16 22014241 missense possibly damaging 0.83
R4847:Senp2 UTSW 16 22038636 missense possibly damaging 0.90
R5207:Senp2 UTSW 16 22041380 missense possibly damaging 0.52
R5509:Senp2 UTSW 16 22040522 missense probably damaging 1.00
R6036:Senp2 UTSW 16 22028558 nonsense probably null
R6036:Senp2 UTSW 16 22028558 nonsense probably null
R6475:Senp2 UTSW 16 22023800 missense probably damaging 1.00
R6517:Senp2 UTSW 16 22026724 missense possibly damaging 0.95
R6923:Senp2 UTSW 16 22011576 intron probably benign
R7287:Senp2 UTSW 16 22018364 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACGACTACATGGGGCACAAG -3'
(R):5'- TGAACTGGCTTCCTCCTCAG -3'

Sequencing Primer
(F):5'- TTTGGTGTTAGGTAAAGAGACCAC -3'
(R):5'- ACCTTTACTACAGAAGACCTTAGAAC -3'
Posted On2015-06-12