Incidental Mutation 'R4233:Gzf1'
ID320945
Institutional Source Beutler Lab
Gene Symbol Gzf1
Ensembl Gene ENSMUSG00000027439
Gene NameGDNF-inducible zinc finger protein 1
SynonymsZfp336, 8430437G08Rik
MMRRC Submission 041642-MU
Accession Numbers

Ncbi RefSeq: NM_028986.3; MGI:1921783

Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R4233 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location148681023-148692949 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 148686533 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 460 (P460S)
Ref Sequence ENSEMBL: ENSMUSP00000028928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028928] [ENSMUST00000131292]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028928
AA Change: P460S

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028928
Gene: ENSMUSG00000027439
AA Change: P460S

DomainStartEndE-ValueType
BTB 31 133 2.01e-20 SMART
low complexity region 199 213 N/A INTRINSIC
coiled coil region 287 308 N/A INTRINSIC
ZnF_C2H2 315 337 6.32e-3 SMART
ZnF_C2H2 346 369 1.2e-3 SMART
ZnF_C2H2 375 398 8.34e-3 SMART
ZnF_C2H2 405 427 7.78e-3 SMART
ZnF_C2H2 433 455 1.69e-3 SMART
ZnF_C2H2 461 483 1.43e-1 SMART
ZnF_C2H2 489 511 2.4e-3 SMART
ZnF_C2H2 517 539 1.47e-3 SMART
ZnF_C2H2 545 567 1.38e-3 SMART
ZnF_C2H2 573 595 1.04e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131292
SMART Domains Protein: ENSMUSP00000121799
Gene: ENSMUSG00000027439

DomainStartEndE-ValueType
BTB 31 133 2.01e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151362
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (53/53)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik A T 5: 138,564,192 Y96N probably damaging Het
Abca15 C T 7: 120,402,979 Q1572* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aph1c A G 9: 66,833,321 F41S probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Arhgef40 T C 14: 51,990,171 V458A possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Ccar2 T C 14: 70,151,091 T169A possibly damaging Het
Cfap58 G A 19: 47,975,555 V541M possibly damaging Het
Coro2b T C 9: 62,426,185 E376G possibly damaging Het
Dnah11 T C 12: 117,916,791 T3865A probably damaging Het
Dync2h1 T C 9: 7,134,360 E1549G probably benign Het
Ercc6l2 T C 13: 63,872,168 probably benign Het
Fam160b2 A C 14: 70,586,878 V473G probably damaging Het
Fbxo32 G T 15: 58,192,333 T135K possibly damaging Het
Fras1 A T 5: 96,714,376 I2205F possibly damaging Het
Gm12034 A G 11: 20,446,785 noncoding transcript Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm5108 C A 5: 67,975,153 T55K unknown Het
Gpa33 A T 1: 166,146,771 D59V probably damaging Het
Gpn2 T A 4: 133,584,705 Y83N probably damaging Het
Ifi203 A T 1: 173,936,533 S124R possibly damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ldlrap1 T A 4: 134,757,338 probably null Het
Madd T C 2: 91,178,236 E107G probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr658 A G 7: 104,644,988 V126A probably benign Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A T 1: 97,864,394 V434D possibly damaging Het
Plxnd1 T C 6: 115,965,953 N1257D probably benign Het
Prkdc C T 16: 15,835,919 A3870V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 T C 13: 11,750,725 D1375G probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc13a2 A G 11: 78,403,535 probably benign Het
Slc7a13 T C 4: 19,819,070 F90S probably damaging Het
Spc24 T C 9: 21,756,202 probably null Het
Stard13 A G 5: 151,062,699 S331P probably benign Het
Sult2a8 T A 7: 14,413,683 I228L probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tshz1 C A 18: 84,016,195 E29D probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Gzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Gzf1 APN 2 148690996 missense probably damaging 0.99
IGL01647:Gzf1 APN 2 148683650 missense probably damaging 1.00
IGL01789:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01791:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01952:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01954:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01956:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL03391:Gzf1 APN 2 148683683 missense probably damaging 1.00
I0000:Gzf1 UTSW 2 148686620 unclassified probably benign
P0019:Gzf1 UTSW 2 148683980 missense probably damaging 1.00
R0420:Gzf1 UTSW 2 148683833 missense probably benign 0.30
R0725:Gzf1 UTSW 2 148684649 nonsense probably null
R1131:Gzf1 UTSW 2 148690867 missense probably benign 0.02
R2000:Gzf1 UTSW 2 148684611 missense probably benign 0.16
R2211:Gzf1 UTSW 2 148684950 missense probably damaging 1.00
R2251:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R2252:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R2253:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R5551:Gzf1 UTSW 2 148684328 missense probably damaging 1.00
R6050:Gzf1 UTSW 2 148684238 missense possibly damaging 0.89
R6891:Gzf1 UTSW 2 148684769 nonsense probably null
R7457:Gzf1 UTSW 2 148690082 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATGGTGAACTTCTGATCAGTTCC -3'
(R):5'- AGGCAGCAGGTATATCTGTAAG -3'

Sequencing Primer
(F):5'- GGTGAACTTCTGATCAGTTCCATTAG -3'
(R):5'- CAGGTATATCTGTAAGCCTGACTCG -3'
Posted On2015-06-12