Mutagenetix > Incidental Mutation

Incidental Mutation 'R4233:Plxnd1'

320958

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

6230425C21Rik, b2b1863Clo, b2b553Clo

MMRRC Submission

041642-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4233 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

115931772-115971966 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115942914 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 1257 (N1257D)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

AlphaFold

Q3UH93

Predicted Effect

probably benign
Transcript: ENSMUST00000015511
AA Change: N1257D

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: N1257D

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131590

SMART Domains

Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

Domain	Start	End	E-Value	Type
Blast:PSI	2	34	1e-13	BLAST
IPT	35	124	4.43e-20	SMART
Blast:IPT	125	177	3e-30	BLAST
Pfam:TIG	180	233	4.6e-6	PFAM

Meta Mutation Damage Score

0.1194

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

100% (53/53)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123K08Rik	A	T	5: 138,562,454 (GRCm39)	Y96N	probably damaging	Het
Abca15	C	T	7: 120,002,202 (GRCm39)	Q1572*	probably null	Het
Ajuba	T	C	14: 54,806,983 (GRCm39)	R490G	probably damaging	Het
Akap6	T	A	12: 53,186,454 (GRCm39)	N1289K	probably damaging	Het
Ankfy1	G	A	11: 72,605,310 (GRCm39)		probably null	Het
Aph1c	A	G	9: 66,740,603 (GRCm39)	F41S	probably damaging	Het
Arhgap21	A	G	2: 20,891,948 (GRCm39)	V161A	probably damaging	Het
Arhgef18	T	C	8: 3,500,317 (GRCm39)	I541T	possibly damaging	Het
Arhgef40	T	C	14: 52,227,628 (GRCm39)	V458A	possibly damaging	Het
Atg14	T	C	14: 47,788,802 (GRCm39)	K184E	probably benign	Het
Casp8	T	C	1: 58,883,929 (GRCm39)	V432A	probably damaging	Het
Ccar2	T	C	14: 70,388,540 (GRCm39)	T169A	possibly damaging	Het
Cfap58	G	A	19: 47,963,994 (GRCm39)	V541M	possibly damaging	Het
Coro2b	T	C	9: 62,333,467 (GRCm39)	E376G	possibly damaging	Het
Dnah11	T	C	12: 117,880,526 (GRCm39)	T3865A	probably damaging	Het
Dync2h1	T	C	9: 7,134,360 (GRCm39)	E1549G	probably benign	Het
Ercc6l2	T	C	13: 64,019,982 (GRCm39)		probably benign	Het
Fbxo32	G	T	15: 58,055,729 (GRCm39)	T135K	possibly damaging	Het
Fhip2b	A	C	14: 70,824,318 (GRCm39)	V473G	probably damaging	Het
Fras1	A	T	5: 96,862,235 (GRCm39)	I2205F	possibly damaging	Het
Gm12034	A	G	11: 20,396,785 (GRCm39)		noncoding transcript	Het
Gm26678	T	C	3: 54,540,504 (GRCm39)		noncoding transcript	Het
Gm5108	C	A	5: 68,132,496 (GRCm39)	T55K	unknown	Het
Gpa33	A	T	1: 165,974,340 (GRCm39)	D59V	probably damaging	Het
Gpn2	T	A	4: 133,312,016 (GRCm39)	Y83N	probably damaging	Het
Gzf1	C	T	2: 148,528,453 (GRCm39)	P460S	possibly damaging	Het
Ifi203	A	T	1: 173,764,099 (GRCm39)	S124R	possibly damaging	Het
Impg1	A	G	9: 80,252,611 (GRCm39)	L523P	probably damaging	Het
Ldlrap1	T	A	4: 134,484,649 (GRCm39)		probably null	Het
Madd	T	C	2: 91,008,581 (GRCm39)	E107G	probably benign	Het
Med12l	T	G	3: 59,164,644 (GRCm39)		probably null	Het
Nxpe4	A	T	9: 48,310,137 (GRCm39)	T467S	probably damaging	Het
Or52n4	A	G	7: 104,294,195 (GRCm39)	V126A	probably benign	Het
Or7g30	T	A	9: 19,352,886 (GRCm39)	L226I	probably damaging	Het
Pam	A	T	1: 97,792,119 (GRCm39)	V434D	possibly damaging	Het
Prkdc	C	T	16: 15,653,783 (GRCm39)	A3870V	probably benign	Het
Ralgapa1	C	T	12: 55,687,429 (GRCm39)	R2019Q	probably damaging	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Ryr2	T	C	13: 11,765,611 (GRCm39)	D1375G	probably benign	Het
Skint11	C	A	4: 114,101,856 (GRCm39)	Q99K	probably benign	Het
Slc13a2	A	G	11: 78,294,361 (GRCm39)		probably benign	Het
Slc7a13	T	C	4: 19,819,070 (GRCm39)	F90S	probably damaging	Het
Spc24	T	C	9: 21,667,498 (GRCm39)		probably null	Het
Stard13	A	G	5: 150,986,164 (GRCm39)	S331P	probably benign	Het
Sult2a8	T	A	7: 14,147,608 (GRCm39)	I228L	probably benign	Het
Tas2r140	A	T	6: 133,031,915 (GRCm39)	V281D	probably damaging	Het
Tmem38b	T	C	4: 53,840,710 (GRCm39)	C66R	probably damaging	Het
Tshz1	C	A	18: 84,034,320 (GRCm39)	E29D	probably benign	Het
Zfp599	T	A	9: 22,161,041 (GRCm39)	K375*	probably null	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115,944,933 (GRCm39)	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115,946,906 (GRCm39)	missense	probably benign
IGL01323:Plxnd1	APN	6	115,943,760 (GRCm39)	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115,937,488 (GRCm39)	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115,936,896 (GRCm39)	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115,955,218 (GRCm39)	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115,970,589 (GRCm39)	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115,940,874 (GRCm39)	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115,932,703 (GRCm39)	makesense	probably null
IGL02873:Plxnd1	APN	6	115,936,937 (GRCm39)	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115,939,318 (GRCm39)	missense	probably damaging	1.00
Hiss	UTSW	6	115,946,890 (GRCm39)	missense	possibly damaging	0.94
murmer	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
mutter	UTSW	6	115,945,005 (GRCm39)	missense	probably benign	0.27
rattle	UTSW	6	115,936,755 (GRCm39)	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115,946,421 (GRCm39)	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115,935,660 (GRCm39)	splice site	probably benign
R0648:Plxnd1	UTSW	6	115,970,962 (GRCm39)	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115,943,599 (GRCm39)	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115,943,966 (GRCm39)	splice site	probably null
R1292:Plxnd1	UTSW	6	115,939,644 (GRCm39)	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115,945,642 (GRCm39)	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115,944,740 (GRCm39)	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115,971,018 (GRCm39)	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115,957,562 (GRCm39)	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115,943,507 (GRCm39)	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115,940,875 (GRCm39)	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115,946,402 (GRCm39)	splice site	probably null
R1865:Plxnd1	UTSW	6	115,946,402 (GRCm39)	splice site	probably null
R1875:Plxnd1	UTSW	6	115,955,045 (GRCm39)	splice site	probably null
R1899:Plxnd1	UTSW	6	115,946,324 (GRCm39)	missense	probably benign
R1913:Plxnd1	UTSW	6	115,954,978 (GRCm39)	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115,939,478 (GRCm39)	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115,944,216 (GRCm39)	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115,934,509 (GRCm39)	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115,939,725 (GRCm39)	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115,941,105 (GRCm39)	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115,939,704 (GRCm39)	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115,944,709 (GRCm39)	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115,936,276 (GRCm39)	missense	probably damaging	1.00
R4280:Plxnd1	UTSW	6	115,933,056 (GRCm39)	splice site	probably null
R4280:Plxnd1	UTSW	6	115,933,055 (GRCm39)	splice site	probably benign
R4346:Plxnd1	UTSW	6	115,954,941 (GRCm39)	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115,970,937 (GRCm39)	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115,932,717 (GRCm39)	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115,945,005 (GRCm39)	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115,971,237 (GRCm39)	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115,949,486 (GRCm39)	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115,935,576 (GRCm39)	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115,935,581 (GRCm39)	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115,937,816 (GRCm39)	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115,932,726 (GRCm39)	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115,971,337 (GRCm39)	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115,942,862 (GRCm39)	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115,935,949 (GRCm39)	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115,934,609 (GRCm39)	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115,942,838 (GRCm39)	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115,945,649 (GRCm39)	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115,944,748 (GRCm39)	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115,955,135 (GRCm39)	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115,954,921 (GRCm39)	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115,955,453 (GRCm39)	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115,953,697 (GRCm39)	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115,946,890 (GRCm39)	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115,970,724 (GRCm39)	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115,949,468 (GRCm39)	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115,937,798 (GRCm39)	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115,953,600 (GRCm39)	missense	probably benign
R7699:Plxnd1	UTSW	6	115,936,755 (GRCm39)	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115,943,879 (GRCm39)	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115,933,578 (GRCm39)	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115,949,433 (GRCm39)	missense	probably benign
R8507:Plxnd1	UTSW	6	115,943,866 (GRCm39)	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115,939,768 (GRCm39)	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115,934,558 (GRCm39)	missense	probably damaging	1.00
R8963:Plxnd1	UTSW	6	115,949,506 (GRCm39)	nonsense	probably null
R9119:Plxnd1	UTSW	6	115,932,832 (GRCm39)	splice site	probably benign
R9177:Plxnd1	UTSW	6	115,943,469 (GRCm39)	missense	probably benign	0.00
R9182:Plxnd1	UTSW	6	115,970,746 (GRCm39)	missense	probably damaging	0.98
R9185:Plxnd1	UTSW	6	115,934,526 (GRCm39)	missense	probably damaging	1.00
R9226:Plxnd1	UTSW	6	115,934,524 (GRCm39)	missense	probably damaging	1.00
R9433:Plxnd1	UTSW	6	115,945,754 (GRCm39)	missense	probably benign	0.00
R9449:Plxnd1	UTSW	6	115,932,730 (GRCm39)	missense	probably damaging	1.00
R9451:Plxnd1	UTSW	6	115,940,277 (GRCm39)	missense	possibly damaging	0.72
R9599:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9627:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9644:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
R9672:Plxnd1	UTSW	6	115,940,274 (GRCm39)	missense	possibly damaging	0.78
X0024:Plxnd1	UTSW	6	115,940,271 (GRCm39)	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115,943,745 (GRCm39)	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115,944,471 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGATCCTACCAATATCTGCCAC -3'
(R):5'- TTGGCCTCTGCACCAAACTC -3'

Sequencing Primer
(F):5'- GTGCCTAACCATGTCCACC -3'
(R):5'- TTGTCTGTGAGGCTCAGA -3'

Posted On

2015-06-12