Incidental Mutation 'R4233:Arhgef40'
ID320980
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene NameRho guanine nucleotide exchange factor (GEF) 40
SynonymsE130112L23Rik
MMRRC Submission 041642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R4233 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location51984719-52006251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51990171 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 458 (V458A)
Ref Sequence ENSEMBL: ENSMUSP00000138354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000182061] [ENSMUST00000182193] [ENSMUST00000182338] [ENSMUST00000182649] [ENSMUST00000182760] [ENSMUST00000182905] [ENSMUST00000182909] [ENSMUST00000183208]
Predicted Effect probably benign
Transcript: ENSMUST00000093813
AA Change: V521A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562
AA Change: V521A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100639
AA Change: V521A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562
AA Change: V521A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182019
Predicted Effect probably benign
Transcript: ENSMUST00000182061
AA Change: V521A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562
AA Change: V521A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182193
Predicted Effect probably benign
Transcript: ENSMUST00000182338
SMART Domains Protein: ENSMUSP00000138482
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 72 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182609
Predicted Effect probably benign
Transcript: ENSMUST00000182649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182740
Predicted Effect probably benign
Transcript: ENSMUST00000182760
AA Change: V521A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562
AA Change: V521A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182905
AA Change: V521A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562
AA Change: V521A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000182909
AA Change: V521A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562
AA Change: V521A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182961
Predicted Effect possibly damaging
Transcript: ENSMUST00000183208
AA Change: V458A

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562
AA Change: V458A

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Meta Mutation Damage Score 0.0548 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik A T 5: 138,564,192 Y96N probably damaging Het
Abca15 C T 7: 120,402,979 Q1572* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aph1c A G 9: 66,833,321 F41S probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Ccar2 T C 14: 70,151,091 T169A possibly damaging Het
Cfap58 G A 19: 47,975,555 V541M possibly damaging Het
Coro2b T C 9: 62,426,185 E376G possibly damaging Het
Dnah11 T C 12: 117,916,791 T3865A probably damaging Het
Dync2h1 T C 9: 7,134,360 E1549G probably benign Het
Ercc6l2 T C 13: 63,872,168 probably benign Het
Fam160b2 A C 14: 70,586,878 V473G probably damaging Het
Fbxo32 G T 15: 58,192,333 T135K possibly damaging Het
Fras1 A T 5: 96,714,376 I2205F possibly damaging Het
Gm12034 A G 11: 20,446,785 noncoding transcript Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm5108 C A 5: 67,975,153 T55K unknown Het
Gpa33 A T 1: 166,146,771 D59V probably damaging Het
Gpn2 T A 4: 133,584,705 Y83N probably damaging Het
Gzf1 C T 2: 148,686,533 P460S possibly damaging Het
Ifi203 A T 1: 173,936,533 S124R possibly damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ldlrap1 T A 4: 134,757,338 probably null Het
Madd T C 2: 91,178,236 E107G probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr658 A G 7: 104,644,988 V126A probably benign Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A T 1: 97,864,394 V434D possibly damaging Het
Plxnd1 T C 6: 115,965,953 N1257D probably benign Het
Prkdc C T 16: 15,835,919 A3870V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 T C 13: 11,750,725 D1375G probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc13a2 A G 11: 78,403,535 probably benign Het
Slc7a13 T C 4: 19,819,070 F90S probably damaging Het
Spc24 T C 9: 21,756,202 probably null Het
Stard13 A G 5: 151,062,699 S331P probably benign Het
Sult2a8 T A 7: 14,413,683 I228L probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tshz1 C A 18: 84,016,195 E29D probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 51988960 missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 51987427 missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 51991698 critical splice donor site probably null
IGL01123:Arhgef40 APN 14 51994346 missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 51989405 missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 51989195 missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52000863 missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 51997408 missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52004907 unclassified probably benign
R0608:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52000993 missense probably benign 0.05
R1126:Arhgef40 UTSW 14 51997126 missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 51990156 missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52004081 missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 51989930 missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 51997623 missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52003705 missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 51996183 missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 51994276 splice site probably benign
R3877:Arhgef40 UTSW 14 52002285 missense probably damaging 1.00
R4596:Arhgef40 UTSW 14 51987224 critical splice donor site probably null
R4676:Arhgef40 UTSW 14 51990959 nonsense probably null
R4703:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52004938 unclassified probably benign
R4915:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 51989689 missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52004099 missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 51989812 missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 51989699 missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 51991849 missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 51996157 missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 51994338 missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52000900 missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 51997032 missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 51987496 missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 51990090 missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52000999 missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 51997431 missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 51990962 unclassified probably benign
R6675:Arhgef40 UTSW 14 51991641 missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 51997897 intron probably benign
R6901:Arhgef40 UTSW 14 51997368 missense probably damaging 1.00
U24488:Arhgef40 UTSW 14 51998216 missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52003684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGACCCCGCAGTGTAC -3'
(R):5'- CCCTACTGCTGGGCTACCA -3'

Sequencing Primer
(F):5'- TGAGATGGCAATGGGGTCC -3'
(R):5'- TGGGGTTACACATCCATACTAGGC -3'
Posted On2015-06-12