Incidental Mutation 'R4234:Dpyd'
ID321002
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Namedihydropyrimidine dehydrogenase
SynonymsDPD, E330028L06Rik
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R4234 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location118562129-119432924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119431584 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1002 (I1002N)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
Predicted Effect probably damaging
Transcript: ENSMUST00000039177
AA Change: I1002N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: I1002N

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Aspg T A 12: 112,123,316 Y429* probably null Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
BC034090 C T 1: 155,241,580 G264D probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cerk T C 15: 86,142,788 K479E probably benign Het
Col19a1 T C 1: 24,315,395 probably null Het
Cyp2c23 G T 19: 44,029,165 T8K unknown Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dok4 T C 8: 94,865,664 E232G probably damaging Het
Dpf1 T C 7: 29,315,632 S304P probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D498G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rbbp5 A G 1: 132,484,758 T20A probably benign Het
Rere T C 4: 150,617,405 V1414A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc27a5 C A 7: 12,988,443 C416F probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Trpc2 T C 7: 102,088,135 I752T possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice acceptor site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTCATTGCATCCGTGTGG -3'
(R):5'- TCACTGGCATTAGACATTGTTTTCC -3'

Sequencing Primer
(F):5'- ATTTGGTACTCTCCATGACTGG -3'
(R):5'- TCACAGCAGCTGTCTTAC -3'
Posted On2015-06-12