Incidental Mutation 'R4234:Rere'
ID321007
Institutional Source Beutler Lab
Gene Symbol Rere
Ensembl Gene ENSMUSG00000039852
Gene Namearginine glutamic acid dipeptide (RE) repeats
Synonyms1110033A15Rik, eyes3, Atr2, eye, atrophin-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4234 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location150281646-150621966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150617405 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1414 (V1414A)
Ref Sequence ENSEMBL: ENSMUSP00000101307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105680] [ENSMUST00000105682] [ENSMUST00000136646]
Predicted Effect probably damaging
Transcript: ENSMUST00000105680
AA Change: V1146A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101305
Gene: ENSMUSG00000039852
AA Change: V1146A

DomainStartEndE-ValueType
ELM2 18 70 1.67e-13 SMART
SANT 124 173 1.8e-6 SMART
low complexity region 176 193 N/A INTRINSIC
ZnF_GATA 233 284 1.94e-15 SMART
Pfam:Atrophin-1 300 1290 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105682
AA Change: V1414A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101307
Gene: ENSMUSG00000039852
AA Change: V1414A

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
BAH 103 283 3.52e-13 SMART
ELM2 286 338 1.67e-13 SMART
SANT 392 441 1.8e-6 SMART
low complexity region 444 461 N/A INTRINSIC
ZnF_GATA 501 552 1.94e-15 SMART
Pfam:Atrophin-1 568 1557 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136646
AA Change: V47A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121544
Gene: ENSMUSG00000039852
AA Change: V47A

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 199 2.2e-122 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000219467
AA Change: V430A
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with abnormalities in neural tube development, somite development, and in the embryonic heart. Mice homozygous for an ENU-induced allele exhibit narrow snouts, decreased body weight, renal agenesis and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Aspg T A 12: 112,123,316 Y429* probably null Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
BC034090 C T 1: 155,241,580 G264D probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cerk T C 15: 86,142,788 K174E probably benign Het
Col19a1 T C 1: 24,315,395 probably null Het
Cyp2c23 G T 19: 44,029,165 T8K unknown Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dok4 T C 8: 94,865,664 E232G probably damaging Het
Dpf1 T C 7: 29,315,632 S304P probably damaging Het
Dpyd T A 3: 119,431,584 I1002N probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D210G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rbbp5 A G 1: 132,484,758 T20A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc27a5 C A 7: 12,988,443 C416F probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Trpc2 T C 7: 102,088,135 I752T possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in Rere
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Rere APN 4 150619463 missense probably damaging 1.00
IGL01465:Rere APN 4 150509994 missense unknown
IGL01523:Rere APN 4 150615555 missense possibly damaging 0.93
IGL01688:Rere APN 4 150618436 missense probably damaging 1.00
IGL02057:Rere APN 4 150614832 unclassified probably benign
IGL02621:Rere APN 4 150613812 unclassified probably benign
IGL02672:Rere APN 4 150510026 missense unknown
R0116:Rere UTSW 4 150616976 missense probably benign 0.18
R0119:Rere UTSW 4 150615322 unclassified probably benign
R0344:Rere UTSW 4 150610981 unclassified probably benign
R0504:Rere UTSW 4 150615322 unclassified probably benign
R0630:Rere UTSW 4 150619088 missense probably damaging 1.00
R0961:Rere UTSW 4 150615372 unclassified probably benign
R1164:Rere UTSW 4 150534884 missense unknown
R1424:Rere UTSW 4 150617038 missense probably damaging 1.00
R1542:Rere UTSW 4 150615942 missense probably damaging 1.00
R1652:Rere UTSW 4 150612065 unclassified probably benign
R1953:Rere UTSW 4 150616837 missense probably damaging 1.00
R1959:Rere UTSW 4 150468790 missense probably benign 0.23
R1966:Rere UTSW 4 150616873 missense probably damaging 1.00
R1975:Rere UTSW 4 150615733 missense probably damaging 0.99
R2070:Rere UTSW 4 150614590 unclassified probably benign
R2115:Rere UTSW 4 150612561 unclassified probably benign
R2144:Rere UTSW 4 150616931 missense probably damaging 0.99
R2270:Rere UTSW 4 150477380 missense unknown
R2969:Rere UTSW 4 150570216 missense unknown
R3699:Rere UTSW 4 150477362 critical splice acceptor site probably null
R3723:Rere UTSW 4 150468795 missense probably damaging 1.00
R3826:Rere UTSW 4 150470328 missense probably benign 0.42
R4512:Rere UTSW 4 150477452 missense unknown
R4798:Rere UTSW 4 150615167 unclassified probably benign
R4883:Rere UTSW 4 150616053 missense probably damaging 0.98
R4914:Rere UTSW 4 150619144 missense probably damaging 1.00
R4916:Rere UTSW 4 150619144 missense probably damaging 1.00
R4917:Rere UTSW 4 150619144 missense probably damaging 1.00
R4918:Rere UTSW 4 150619144 missense probably damaging 1.00
R4966:Rere UTSW 4 150613816 unclassified probably benign
R5172:Rere UTSW 4 150570269 missense unknown
R5643:Rere UTSW 4 150617243 missense probably damaging 1.00
R6058:Rere UTSW 4 150468798 missense probably damaging 1.00
R7112:Rere UTSW 4 150406604 missense probably benign
R7173:Rere UTSW 4 150468738 missense probably damaging 1.00
R7190:Rere UTSW 4 150610953 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCCCATGGAGCATTTTGC -3'
(R):5'- CAGGACTAGGCTTCTCTAGAGG -3'

Sequencing Primer
(F):5'- ATGGAGCATTTTGCCCGGC -3'
(R):5'- GCCTTGCTTCTGAATTGG -3'
Posted On2015-06-12