Mutagenetix > Incidental Mutation

Incidental Mutation 'R4235:Has1'

321094

Institutional Source

Beutler Lab

Gene Symbol

Has1

Ensembl Gene

ENSMUSG00000003665

Gene Name

hyaluronan synthase 1

Synonyms

MMRRC Submission

041052-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4235 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

18063588-18075450 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 18070298 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 208 (R208S)

Ref Sequence

ENSEMBL: ENSMUSP00000003762 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003762]

AlphaFold

Q61647

Predicted Effect

possibly damaging
Transcript: ENSMUST00000003762
AA Change: R208S

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000003762
Gene: ENSMUSG00000003665
AA Change: R208S

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC
transmembrane domain	53	75	N/A	INTRINSIC
low complexity region	78	86	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	179	387	1.1e-21	PFAM
Pfam:Glyco_transf_21	205	386	1.2e-8	PFAM
Pfam:Chitin_synth_2	222	394	1.6e-16	PFAM
Pfam:Glyco_trans_2_3	237	453	5.6e-16	PFAM
transmembrane domain	464	486	N/A	INTRINSIC
transmembrane domain	501	523	N/A	INTRINSIC
transmembrane domain	544	566	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232410

Meta Mutation Damage Score

0.0720

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS1 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to the hasA gene product of Streptococcus pyogenes, a glycosaminoglycan synthetase (DG42) from Xenopus laevis, and a recently described murine hyaluronan synthase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and appear grossly normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 69,438,135 (GRCm39)	A53T	probably benign	Het
5730596B20Rik	G	T	6: 52,155,941 (GRCm39)		probably benign	Het
Akap6	T	A	12: 53,186,454 (GRCm39)	N1289K	probably damaging	Het
Arhgap21	A	G	2: 20,891,948 (GRCm39)	V161A	probably damaging	Het
Arhgef18	T	C	8: 3,500,317 (GRCm39)	I541T	possibly damaging	Het
Atp7b	A	G	8: 22,501,039 (GRCm39)	Y955H	possibly damaging	Het
Bnc2	A	G	4: 84,211,751 (GRCm39)	V231A	probably damaging	Het
Bod1l	A	G	5: 41,978,798 (GRCm39)	S839P	probably damaging	Het
Casp8	T	A	1: 58,872,857 (GRCm39)	H264Q	possibly damaging	Het
Cc2d1b	A	T	4: 108,482,549 (GRCm39)		probably benign	Het
Cpne6	A	T	14: 55,751,057 (GRCm39)		probably benign	Het
Ddx1	C	T	12: 13,273,858 (GRCm39)	V590I	possibly damaging	Het
Dgkd	T	A	1: 87,859,704 (GRCm39)	L774*	probably null	Het
Fbxl2	T	A	9: 113,818,231 (GRCm39)	N205I	probably benign	Het
Fcgbpl1	T	A	7: 27,856,073 (GRCm39)	D1953E	probably damaging	Het
Fkbp15	A	T	4: 62,254,693 (GRCm39)	I269K	probably benign	Het
Gm26678	T	C	3: 54,540,504 (GRCm39)		noncoding transcript	Het
Hecw1	C	G	13: 14,491,724 (GRCm39)	A423P	probably benign	Het
Hspa12b	T	C	2: 130,980,932 (GRCm39)	V162A	probably benign	Het
Ifi208	T	G	1: 173,510,477 (GRCm39)	S211A	probably benign	Het
Ighv6-3	T	C	12: 114,355,494 (GRCm39)	E65G	probably damaging	Het
Igkv9-120	A	T	6: 68,027,317 (GRCm39)	D77V	probably benign	Het
Impg1	A	G	9: 80,252,611 (GRCm39)	L523P	probably damaging	Het
Ip6k2	G	A	9: 108,682,847 (GRCm39)	R319Q	probably benign	Het
Kdm2a	A	G	19: 4,372,549 (GRCm39)	I932T	probably damaging	Het
Krt17	T	C	11: 100,148,694 (GRCm39)	T279A	possibly damaging	Het
Lamp1	T	C	8: 13,217,192 (GRCm39)	V67A	possibly damaging	Het
Limk1	T	C	5: 134,699,332 (GRCm39)	I142V	probably benign	Het
Mamdc2	T	C	19: 23,351,381 (GRCm39)	N182D	possibly damaging	Het
Mcpt1	G	A	14: 56,256,017 (GRCm39)		probably null	Het
Med12l	T	G	3: 59,164,644 (GRCm39)		probably null	Het
Mfsd10	G	T	5: 34,792,969 (GRCm39)	T44N	probably damaging	Het
Mrps27	T	C	13: 99,541,549 (GRCm39)	S218P	probably damaging	Het
Mrps30	T	C	13: 118,523,376 (GRCm39)	D132G	probably damaging	Het
Neil2	A	C	14: 63,429,290 (GRCm39)	M1R	probably null	Het
Nelfcd	T	C	2: 174,268,841 (GRCm39)	F587L	probably damaging	Het
Nfil3	T	C	13: 53,122,835 (GRCm39)	D23G	probably benign	Het
Nit2	T	C	16: 56,977,523 (GRCm39)	K169R	probably benign	Het
Nxt1	T	C	2: 148,517,267 (GRCm39)	S3P	probably benign	Het
Ogt	A	G	X: 100,711,131 (GRCm39)	N434D	probably damaging	Het
Or56a3	T	A	7: 104,734,994 (GRCm39)	S24T	possibly damaging	Het
Pcdhga5	A	G	18: 37,829,001 (GRCm39)	D483G	possibly damaging	Het
Pramel25	G	C	4: 143,521,344 (GRCm39)	C320S	probably damaging	Het
Ralgapa1	C	T	12: 55,687,429 (GRCm39)	R2019Q	probably damaging	Het
Rsl1	T	C	13: 67,325,226 (GRCm39)		probably null	Het
Sobp	G	A	10: 42,898,896 (GRCm39)	H230Y	probably damaging	Het
Sptan1	A	G	2: 29,916,600 (GRCm39)	E2096G	probably damaging	Het
Tie1	G	T	4: 118,335,602 (GRCm39)	S797*	probably null	Het
Tmem266	T	C	9: 55,325,391 (GRCm39)	I186T	probably damaging	Het
Tmem38b	T	C	4: 53,840,710 (GRCm39)	C66R	probably damaging	Het
Tnfaip6	T	C	2: 51,940,876 (GRCm39)	F139S	probably damaging	Het
Tnrc6a	T	C	7: 122,770,903 (GRCm39)	S898P	probably benign	Het
Trim24	A	G	6: 37,941,675 (GRCm39)	D911G	probably damaging	Het
Tyw5	T	C	1: 57,427,647 (GRCm39)		probably benign	Het
Ubr3	C	T	2: 69,846,729 (GRCm39)	Q1651*	probably null	Het
Unc13c	T	A	9: 73,438,234 (GRCm39)	I1943F	possibly damaging	Het
Usp47	T	A	7: 111,709,255 (GRCm39)	S1334T	probably damaging	Het
Vmn1r215	T	A	13: 23,260,101 (GRCm39)	V47E	probably benign	Het
Vmn1r224	T	A	17: 20,639,624 (GRCm39)	M67K	possibly damaging	Het
Wdfy3	T	A	5: 102,070,500 (GRCm39)		probably null	Het
Zfc3h1	T	C	10: 115,254,704 (GRCm39)	Y1433H	probably benign	Het

Other mutations in Has1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01563:Has1	APN	17	18,063,924 (GRCm39)	unclassified	probably benign
IGL02551:Has1	APN	17	18,068,560 (GRCm39)	missense	probably damaging	1.00
R0149:Has1	UTSW	17	18,070,433 (GRCm39)	missense	probably damaging	1.00
R0496:Has1	UTSW	17	18,064,008 (GRCm39)	missense	probably benign
R0637:Has1	UTSW	17	18,064,125 (GRCm39)	missense	possibly damaging	0.67
R1051:Has1	UTSW	17	18,068,541 (GRCm39)	missense	probably damaging	1.00
R1647:Has1	UTSW	17	18,070,247 (GRCm39)	missense	probably damaging	1.00
R1648:Has1	UTSW	17	18,070,247 (GRCm39)	missense	probably damaging	1.00
R1768:Has1	UTSW	17	18,070,562 (GRCm39)	missense	probably benign
R2016:Has1	UTSW	17	18,068,532 (GRCm39)	missense	probably damaging	1.00
R3810:Has1	UTSW	17	18,067,822 (GRCm39)	missense	probably damaging	0.98
R4467:Has1	UTSW	17	18,064,257 (GRCm39)	missense	probably benign	0.05
R5475:Has1	UTSW	17	18,068,583 (GRCm39)	missense	possibly damaging	0.57
R5682:Has1	UTSW	17	18,064,425 (GRCm39)	missense	possibly damaging	0.58
R6418:Has1	UTSW	17	18,070,207 (GRCm39)	missense	probably damaging	1.00
R6841:Has1	UTSW	17	18,064,122 (GRCm39)	missense	probably benign	0.06
R7076:Has1	UTSW	17	18,064,068 (GRCm39)	missense	probably damaging	1.00
R7767:Has1	UTSW	17	18,070,792 (GRCm39)	missense	probably damaging	1.00
R8878:Has1	UTSW	17	18,070,321 (GRCm39)	missense	possibly damaging	0.57
R9002:Has1	UTSW	17	18,063,912 (GRCm39)	missense	unknown
R9502:Has1	UTSW	17	18,063,971 (GRCm39)	missense	probably damaging	1.00
X0028:Has1	UTSW	17	18,070,715 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGACTGAATTTCTGATCCTTGCG -3'
(R):5'- TGTTCCGAGAAGTCTTCGCC -3'

Sequencing Primer
(F):5'- ATGGGCTTGGATGCACCCTAC -3'
(R):5'- AAGTCTTCGCCGATGAGGAC -3'

Posted On

2015-06-12