Incidental Mutation 'R4236:Casp8'
List |< first << previous [record 9 of 47] next >> last >|
ID321102
Institutional Source Beutler Lab
Gene Symbol Casp8
Ensembl Gene ENSMUSG00000026029
Gene Namecaspase 8
SynonymsMACH, Mch5, FLICE, Caspase-8
MMRRC Submission 041053-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4236 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58795374-58847503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58844770 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 432 (V432A)
Ref Sequence ENSEMBL: ENSMUSP00000140546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027189] [ENSMUST00000165549] [ENSMUST00000190213] [ENSMUST00000191201]
Predicted Effect probably damaging
Transcript: ENSMUST00000027189
AA Change: V412A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027189
Gene: ENSMUSG00000026029
AA Change: V412A

DomainStartEndE-ValueType
DED 1 80 3.21e-23 SMART
DED 99 178 1.01e-15 SMART
CASc 227 480 2.13e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165549
AA Change: V412A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127375
Gene: ENSMUSG00000026029
AA Change: V412A

DomainStartEndE-ValueType
DED 1 80 3.21e-23 SMART
DED 99 178 1.01e-15 SMART
CASc 227 480 2.13e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190213
AA Change: V432A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140335
Gene: ENSMUSG00000026029
AA Change: V432A

DomainStartEndE-ValueType
DED 21 100 1.5e-25 SMART
DED 119 198 5e-18 SMART
CASc 247 500 1.1e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191201
AA Change: V432A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140546
Gene: ENSMUSG00000026029
AA Change: V432A

DomainStartEndE-ValueType
DED 21 100 1.5e-25 SMART
DED 119 198 5e-18 SMART
CASc 247 500 1.1e-112 SMART
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: This gene is part of a family of caspases, aspartate-specific cysteine proteases well studied for their involvement in immune and apoptosis signaling. This protein, an initiator of apoptotic cell death, is activated by death-inducing tumor necrosis family receptors and targets downstream effectors. In mouse deficiency of this gene can cause embryonic lethality. This protein may have a role in embryogenesis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired cardiac muscle development, cardiac erythrocyte congestion, low numbers of colony-forming cells, and prenatal lethality. T-cell restricted knockout mice are viable, but immunodeficient. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abca13 A T 11: 9,256,205 K168N probably damaging Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Cela1 T C 15: 100,682,913 Y91C probably damaging Het
Chrnb3 C A 8: 27,393,993 L253M probably damaging Het
Col24a1 G T 3: 145,524,282 G1493* probably null Het
Dnah7a C T 1: 53,447,365 E3346K probably benign Het
Dock5 A T 14: 67,756,492 S1845T probably benign Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
F2rl1 A G 13: 95,513,288 L362P probably damaging Het
Gal3st2c T C 1: 94,008,741 F136S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm8300 A T 12: 87,517,165 D90V probably damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Klhl23 T C 2: 69,824,172 F129L probably damaging Het
Krt71 T C 15: 101,734,694 T460A probably benign Het
Madd C T 2: 91,167,028 R746Q probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh6 T G 14: 54,960,362 M440L probably benign Het
Myh7 T A 14: 54,991,118 S205C probably benign Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Pde3b A G 7: 114,521,688 T683A possibly damaging Het
Plcb2 A T 2: 118,709,566 L1082Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc6a6 T C 6: 91,741,276 V357A probably damaging Het
Slitrk6 T C 14: 110,750,148 E709G probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tfcp2l1 G A 1: 118,662,065 R285H probably benign Het
Tmem132d A G 5: 128,432,325 S14P possibly damaging Het
Tulp2 A G 7: 45,521,874 K360E probably damaging Het
Vmn1r60 A G 7: 5,544,804 V99A probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Casp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Casp8 APN 1 58827314 critical splice donor site probably null
IGL00825:Casp8 APN 1 58829006 missense probably benign 0.02
IGL02025:Casp8 APN 1 58824147 missense possibly damaging 0.81
IGL02549:Casp8 APN 1 58833766 missense probably benign
amontillado UTSW 1 58844770 missense probably damaging 1.00
Porto UTSW 1 58833698 missense possibly damaging 0.89
IGL02991:Casp8 UTSW 1 58827279 missense probably benign 0.00
R0609:Casp8 UTSW 1 58844792 missense probably benign 0.00
R0960:Casp8 UTSW 1 58829013 critical splice donor site probably null
R1433:Casp8 UTSW 1 58824124 missense probably damaging 1.00
R1505:Casp8 UTSW 1 58828922 missense probably damaging 0.99
R1506:Casp8 UTSW 1 58824196 missense probably damaging 0.97
R1596:Casp8 UTSW 1 58831674 splice site probably benign
R1674:Casp8 UTSW 1 58844416 missense probably damaging 1.00
R1676:Casp8 UTSW 1 58844416 missense probably damaging 1.00
R1981:Casp8 UTSW 1 58828962 synonymous probably null
R3909:Casp8 UTSW 1 58844811 missense probably damaging 1.00
R3911:Casp8 UTSW 1 58833705 missense probably damaging 1.00
R4231:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4233:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4234:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4235:Casp8 UTSW 1 58833698 missense possibly damaging 0.89
R4917:Casp8 UTSW 1 58827218 missense probably damaging 1.00
R4918:Casp8 UTSW 1 58827218 missense probably damaging 1.00
R5063:Casp8 UTSW 1 58844374 missense probably damaging 1.00
R5092:Casp8 UTSW 1 58844676 missense possibly damaging 0.53
R5153:Casp8 UTSW 1 58844845 missense probably benign 0.00
R5964:Casp8 UTSW 1 58833736 missense possibly damaging 0.62
R5979:Casp8 UTSW 1 58828912 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGTGCCCTTCCCTGTCTG -3'
(R):5'- GCCAATGGCTACTTCTCTGCTTAG -3'

Sequencing Primer
(F):5'- GCTTGCCAAGGAAGTAAC -3'
(R):5'- TCTGCTTAGTATATATTATCTCGGCC -3'
Posted On2015-06-12