Incidental Mutation 'R4236:Tfcp2l1'
ID321105
Institutional Source Beutler Lab
Gene Symbol Tfcp2l1
Ensembl Gene ENSMUSG00000026380
Gene Nametranscription factor CP2-like 1
SynonymsLBP-9, 4932442M07Rik, Crtr-1, 1810030F05Rik, D930018N21Rik, Cp2l1, Tcfcp2l1
MMRRC Submission 041053-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock #R4236 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location118627945-118685168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118662065 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 285 (R285H)
Ref Sequence ENSEMBL: ENSMUSP00000027629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027629]
Predicted Effect probably benign
Transcript: ENSMUST00000027629
AA Change: R285H

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027629
Gene: ENSMUSG00000026380
AA Change: R285H

DomainStartEndE-ValueType
Pfam:CP2 27 240 2e-58 PFAM
low complexity region 377 390 N/A INTRINSIC
low complexity region 406 416 N/A INTRINSIC
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (49/51)
MGI Phenotype PHENOTYPE: Mice homozygous for either a knock-out or a gene-trapped allele display a phenotype characterized by postnatal growth retardation, renal hypoplasia, impaired maturation of the ducts in the salivary gland and kidney, abnormal composition of saliva and urine, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abca13 A T 11: 9,256,205 K168N probably damaging Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cela1 T C 15: 100,682,913 Y91C probably damaging Het
Chrnb3 C A 8: 27,393,993 L253M probably damaging Het
Col24a1 G T 3: 145,524,282 G1493* probably null Het
Dnah7a C T 1: 53,447,365 E3346K probably benign Het
Dock5 A T 14: 67,756,492 S1845T probably benign Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
F2rl1 A G 13: 95,513,288 L362P probably damaging Het
Gal3st2c T C 1: 94,008,741 F136S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm8300 A T 12: 87,517,165 D90V probably damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Klhl23 T C 2: 69,824,172 F129L probably damaging Het
Krt71 T C 15: 101,734,694 T460A probably benign Het
Madd C T 2: 91,167,028 R746Q probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh6 T G 14: 54,960,362 M440L probably benign Het
Myh7 T A 14: 54,991,118 S205C probably benign Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Pde3b A G 7: 114,521,688 T683A possibly damaging Het
Plcb2 A T 2: 118,709,566 L1082Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc6a6 T C 6: 91,741,276 V357A probably damaging Het
Slitrk6 T C 14: 110,750,148 E709G probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tmem132d A G 5: 128,432,325 S14P possibly damaging Het
Tulp2 A G 7: 45,521,874 K360E probably damaging Het
Vmn1r60 A G 7: 5,544,804 V99A probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Tfcp2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Tfcp2l1 APN 1 118652882 missense possibly damaging 0.70
IGL01725:Tfcp2l1 APN 1 118668636 missense possibly damaging 0.80
IGL02281:Tfcp2l1 APN 1 118669380 splice site probably benign
R1272:Tfcp2l1 UTSW 1 118632313 missense probably damaging 1.00
R1680:Tfcp2l1 UTSW 1 118675605 missense probably damaging 0.99
R1959:Tfcp2l1 UTSW 1 118669389 missense probably benign 0.40
R1965:Tfcp2l1 UTSW 1 118652923 nonsense probably null
R3928:Tfcp2l1 UTSW 1 118669476 missense possibly damaging 0.92
R4678:Tfcp2l1 UTSW 1 118668648 missense probably benign 0.33
R4839:Tfcp2l1 UTSW 1 118669464 missense probably benign 0.00
R4858:Tfcp2l1 UTSW 1 118669509 missense possibly damaging 0.62
R5587:Tfcp2l1 UTSW 1 118664762 missense possibly damaging 0.59
R5679:Tfcp2l1 UTSW 1 118668647 missense probably benign
R6899:Tfcp2l1 UTSW 1 118675575 missense probably benign
R7010:Tfcp2l1 UTSW 1 118653727 missense probably damaging 1.00
R7155:Tfcp2l1 UTSW 1 118668632 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGAATGCTTGCTTCCGC -3'
(R):5'- AGAAAAGAGCATGCACGCAT -3'

Sequencing Primer
(F):5'- CTTCCGCAGAAGGGCCC -3'
(R):5'- CTCAAAGATATCTGGGCCGTG -3'
Posted On2015-06-12