Incidental Mutation 'R4236:Pcdh7'
ID321115
Institutional Source Beutler Lab
Gene Symbol Pcdh7
Ensembl Gene ENSMUSG00000029108
Gene Nameprotocadherin 7
SynonymsBH-protocadherin
MMRRC Submission 041053-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R4236 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location57717967-58133230 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57719289 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 62 (G62D)
Ref Sequence ENSEMBL: ENSMUSP00000092376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068110] [ENSMUST00000094783] [ENSMUST00000191837] [ENSMUST00000199310]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068110
AA Change: G62D

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066306
Gene: ENSMUSG00000029108
AA Change: G62D

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094783
AA Change: G62D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092376
Gene: ENSMUSG00000029108
AA Change: G62D

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180708
Predicted Effect possibly damaging
Transcript: ENSMUST00000191837
AA Change: G62D

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142319
Gene: ENSMUSG00000029108
AA Change: G62D

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192048
Predicted Effect probably benign
Transcript: ENSMUST00000192287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193156
Predicted Effect probably benign
Transcript: ENSMUST00000195156
Predicted Effect probably benign
Transcript: ENSMUST00000199310
SMART Domains Protein: ENSMUSP00000143387
Gene: ENSMUSG00000029108

DomainStartEndE-ValueType
Pfam:Protocadherin 1 79 5.1e-40 PFAM
low complexity region 112 123 N/A INTRINSIC
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a protein with an extracellular domain containing 7 cadherin repeats. The gene product is an integral membrane protein that is thought to function in cell-cell recognition and adhesion. Alternative splicing yields isoforms with unique cytoplasmic tails. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abca13 A T 11: 9,256,205 K168N probably damaging Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cela1 T C 15: 100,682,913 Y91C probably damaging Het
Chrnb3 C A 8: 27,393,993 L253M probably damaging Het
Col24a1 G T 3: 145,524,282 G1493* probably null Het
Dnah7a C T 1: 53,447,365 E3346K probably benign Het
Dock5 A T 14: 67,756,492 S1845T probably benign Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
F2rl1 A G 13: 95,513,288 L362P probably damaging Het
Gal3st2c T C 1: 94,008,741 F136S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm8300 A T 12: 87,517,165 D90V probably damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Klhl23 T C 2: 69,824,172 F129L probably damaging Het
Krt71 T C 15: 101,734,694 T460A probably benign Het
Madd C T 2: 91,167,028 R746Q probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh6 T G 14: 54,960,362 M440L probably benign Het
Myh7 T A 14: 54,991,118 S205C probably benign Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pde3b A G 7: 114,521,688 T683A possibly damaging Het
Plcb2 A T 2: 118,709,566 L1082Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc6a6 T C 6: 91,741,276 V357A probably damaging Het
Slitrk6 T C 14: 110,750,148 E709G probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tfcp2l1 G A 1: 118,662,065 R285H probably benign Het
Tmem132d A G 5: 128,432,325 S14P possibly damaging Het
Tulp2 A G 7: 45,521,874 K360E probably damaging Het
Vmn1r60 A G 7: 5,544,804 V99A probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Pcdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Pcdh7 APN 5 57721464 missense probably damaging 1.00
IGL00920:Pcdh7 APN 5 57720131 missense probably damaging 0.96
IGL00990:Pcdh7 APN 5 57720464 missense possibly damaging 0.94
IGL01367:Pcdh7 APN 5 58129224 missense possibly damaging 0.67
IGL01388:Pcdh7 APN 5 57720204 missense probably damaging 1.00
IGL01543:Pcdh7 APN 5 57720765 missense probably damaging 1.00
IGL01750:Pcdh7 APN 5 57720422 missense probably damaging 1.00
IGL02010:Pcdh7 APN 5 58129255 missense probably benign
IGL02014:Pcdh7 APN 5 57719703 missense probably benign 0.03
IGL02269:Pcdh7 APN 5 57913322 missense probably damaging 1.00
IGL03051:Pcdh7 APN 5 58129073 missense probably damaging 0.99
P0037:Pcdh7 UTSW 5 57913248 missense probably benign 0.17
R0003:Pcdh7 UTSW 5 57913248 missense probably benign 0.17
R0421:Pcdh7 UTSW 5 57720060 missense probably damaging 1.00
R0551:Pcdh7 UTSW 5 57721994 missense probably damaging 0.99
R0562:Pcdh7 UTSW 5 57720063 missense probably damaging 0.99
R0732:Pcdh7 UTSW 5 57721315 missense probably damaging 1.00
R0755:Pcdh7 UTSW 5 57720322 missense possibly damaging 0.86
R1080:Pcdh7 UTSW 5 57719426 missense probably damaging 1.00
R1381:Pcdh7 UTSW 5 57721540 nonsense probably null
R1591:Pcdh7 UTSW 5 57720422 missense probably damaging 1.00
R1891:Pcdh7 UTSW 5 57720875 missense probably damaging 0.98
R2011:Pcdh7 UTSW 5 57719629 missense probably damaging 1.00
R2140:Pcdh7 UTSW 5 58128996 missense probably damaging 1.00
R2147:Pcdh7 UTSW 5 58129116 missense possibly damaging 0.51
R2848:Pcdh7 UTSW 5 57720276 missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57721894 missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57721894 missense probably damaging 1.00
R3719:Pcdh7 UTSW 5 58129032 missense probably damaging 1.00
R4075:Pcdh7 UTSW 5 57721808 missense probably damaging 1.00
R4231:Pcdh7 UTSW 5 57719289 missense possibly damaging 0.94
R4352:Pcdh7 UTSW 5 57722019 missense possibly damaging 0.88
R4420:Pcdh7 UTSW 5 58129170 missense probably benign 0.03
R4449:Pcdh7 UTSW 5 57720485 missense probably damaging 1.00
R4584:Pcdh7 UTSW 5 57721283 missense probably damaging 1.00
R4686:Pcdh7 UTSW 5 58129169 missense probably benign
R4837:Pcdh7 UTSW 5 57720411 missense possibly damaging 0.89
R4838:Pcdh7 UTSW 5 57720804 missense probably damaging 1.00
R4947:Pcdh7 UTSW 5 57721916 missense probably damaging 0.98
R5053:Pcdh7 UTSW 5 57721601 missense probably damaging 0.99
R5068:Pcdh7 UTSW 5 57722166 missense probably damaging 1.00
R5117:Pcdh7 UTSW 5 57721748 missense probably benign 0.09
R5132:Pcdh7 UTSW 5 57728121 missense probably benign
R5248:Pcdh7 UTSW 5 58129173 missense probably damaging 0.97
R5294:Pcdh7 UTSW 5 57728111 splice site probably null
R5420:Pcdh7 UTSW 5 57720187 missense probably damaging 1.00
R5777:Pcdh7 UTSW 5 57719514 missense probably damaging 1.00
R5800:Pcdh7 UTSW 5 57722225 missense probably damaging 1.00
R5834:Pcdh7 UTSW 5 57721628 missense possibly damaging 0.90
R5870:Pcdh7 UTSW 5 57720411 missense possibly damaging 0.89
R5917:Pcdh7 UTSW 5 57721755 missense probably damaging 0.96
R6014:Pcdh7 UTSW 5 57721155 missense probably damaging 0.99
R6193:Pcdh7 UTSW 5 57720324 missense probably damaging 1.00
R6240:Pcdh7 UTSW 5 57721362 missense probably damaging 1.00
R6335:Pcdh7 UTSW 5 57942265 unclassified probably null
R6418:Pcdh7 UTSW 5 57721704 missense probably damaging 1.00
R6907:Pcdh7 UTSW 5 57719129 missense possibly damaging 0.53
R7058:Pcdh7 UTSW 5 57722240 missense probably damaging 0.99
R7069:Pcdh7 UTSW 5 57719784 missense probably benign 0.00
R7073:Pcdh7 UTSW 5 57720957 missense probably benign 0.19
X0021:Pcdh7 UTSW 5 57721484 missense possibly damaging 0.95
X0026:Pcdh7 UTSW 5 57719379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTCCTTTCCCGGAGAGG -3'
(R):5'- TTGATGTCCAGCACGATGAC -3'

Sequencing Primer
(F):5'- ATGCTGAGGATGCGGACCAC -3'
(R):5'- AGCTCTGTGAGGGCCCTATC -3'
Posted On2015-06-12