Incidental Mutation 'R4236:Tas2r140'
ID321118
Institutional Source Beutler Lab
Gene Symbol Tas2r140
Ensembl Gene ENSMUSG00000071147
Gene Nametaste receptor, type 2, member 140
SynonymsTas2r40, TRB5, T2R40, TRB3, mTRB3, Tas2r13, mt2r64
MMRRC Submission 041053-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4236 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location133054817-133055816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133054952 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 281 (V281D)
Ref Sequence ENSEMBL: ENSMUSP00000093040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095391]
Predicted Effect probably damaging
Transcript: ENSMUST00000095391
AA Change: V281D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093040
Gene: ENSMUSG00000071147
AA Change: V281D

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 6.7e-86 PFAM
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abca13 A T 11: 9,256,205 K168N probably damaging Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cela1 T C 15: 100,682,913 Y91C probably damaging Het
Chrnb3 C A 8: 27,393,993 L253M probably damaging Het
Col24a1 G T 3: 145,524,282 G1493* probably null Het
Dnah7a C T 1: 53,447,365 E3346K probably benign Het
Dock5 A T 14: 67,756,492 S1845T probably benign Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
F2rl1 A G 13: 95,513,288 L362P probably damaging Het
Gal3st2c T C 1: 94,008,741 F136S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm8300 A T 12: 87,517,165 D90V probably damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Klhl23 T C 2: 69,824,172 F129L probably damaging Het
Krt71 T C 15: 101,734,694 T460A probably benign Het
Madd C T 2: 91,167,028 R746Q probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh6 T G 14: 54,960,362 M440L probably benign Het
Myh7 T A 14: 54,991,118 S205C probably benign Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Pde3b A G 7: 114,521,688 T683A possibly damaging Het
Plcb2 A T 2: 118,709,566 L1082Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc6a6 T C 6: 91,741,276 V357A probably damaging Het
Slitrk6 T C 14: 110,750,148 E709G probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tfcp2l1 G A 1: 118,662,065 R285H probably benign Het
Tmem132d A G 5: 128,432,325 S14P possibly damaging Het
Tulp2 A G 7: 45,521,874 K360E probably damaging Het
Vmn1r60 A G 7: 5,544,804 V99A probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Tas2r140
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0244:Tas2r140 UTSW 6 133055327 missense possibly damaging 0.46
R0666:Tas2r140 UTSW 6 133055442 missense probably benign 0.22
R1174:Tas2r140 UTSW 6 133054871 missense probably benign 0.27
R1237:Tas2r140 UTSW 6 133055208 missense probably benign 0.04
R1553:Tas2r140 UTSW 6 133055508 missense probably damaging 0.99
R2030:Tas2r140 UTSW 6 133055250 missense probably benign 0.23
R3123:Tas2r140 UTSW 6 133055241 missense probably benign 0.05
R3124:Tas2r140 UTSW 6 133055241 missense probably benign 0.05
R4233:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4234:Tas2r140 UTSW 6 133054952 missense probably damaging 1.00
R4525:Tas2r140 UTSW 6 133055244 missense possibly damaging 0.66
R4803:Tas2r140 UTSW 6 133055780 missense possibly damaging 0.77
R4840:Tas2r140 UTSW 6 133055565 missense probably benign 0.01
R5317:Tas2r140 UTSW 6 133055580 missense probably benign 0.06
R5937:Tas2r140 UTSW 6 133055273 missense probably benign 0.01
R6142:Tas2r140 UTSW 6 133055735 missense probably damaging 1.00
R7127:Tas2r140 UTSW 6 133054959 missense possibly damaging 0.62
R7143:Tas2r140 UTSW 6 133055519 missense probably benign 0.00
R7178:Tas2r140 UTSW 6 133055660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTACAGTACTTGATTCCCAAAG -3'
(R):5'- GCCCATATTAAGGCCCTGC -3'

Sequencing Primer
(F):5'- CAGTACTTGATTCCCAAAGAATTTTG -3'
(R):5'- TTAAGGCCCTGCAAATGATGGTC -3'
Posted On2015-06-12