Incidental Mutation 'R4236:Olfr53'
List |< first << previous [record 31 of 47] next >> last >|
ID321123
Institutional Source Beutler Lab
Gene Symbol Olfr53
Ensembl Gene ENSMUSG00000094819
Gene Nameolfactory receptor 53
SynonymsGA_x6K02T2PBJ9-42798103-42799038, IE12, MOR253-5
MMRRC Submission 041053-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4236 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140646452-140653085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140652740 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 254 (Y254H)
Ref Sequence ENSEMBL: ENSMUSP00000081494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084456] [ENSMUST00000211057] [ENSMUST00000211399]
Predicted Effect probably damaging
Transcript: ENSMUST00000084456
AA Change: Y254H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081494
Gene: ENSMUSG00000094819
AA Change: Y254H

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.5e-51 PFAM
Pfam:7TM_GPCR_Srsx 37 208 9.7e-7 PFAM
Pfam:7tm_1 43 292 1.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211057
Predicted Effect probably benign
Transcript: ENSMUST00000211399
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abca13 A T 11: 9,256,205 K168N probably damaging Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cela1 T C 15: 100,682,913 Y91C probably damaging Het
Chrnb3 C A 8: 27,393,993 L253M probably damaging Het
Col24a1 G T 3: 145,524,282 G1493* probably null Het
Dnah7a C T 1: 53,447,365 E3346K probably benign Het
Dock5 A T 14: 67,756,492 S1845T probably benign Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
F2rl1 A G 13: 95,513,288 L362P probably damaging Het
Gal3st2c T C 1: 94,008,741 F136S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm8300 A T 12: 87,517,165 D90V probably damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Klhl23 T C 2: 69,824,172 F129L probably damaging Het
Krt71 T C 15: 101,734,694 T460A probably benign Het
Madd C T 2: 91,167,028 R746Q probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh6 T G 14: 54,960,362 M440L probably benign Het
Myh7 T A 14: 54,991,118 S205C probably benign Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Pde3b A G 7: 114,521,688 T683A possibly damaging Het
Plcb2 A T 2: 118,709,566 L1082Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc6a6 T C 6: 91,741,276 V357A probably damaging Het
Slitrk6 T C 14: 110,750,148 E709G probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tfcp2l1 G A 1: 118,662,065 R285H probably benign Het
Tmem132d A G 5: 128,432,325 S14P possibly damaging Het
Tulp2 A G 7: 45,521,874 K360E probably damaging Het
Vmn1r60 A G 7: 5,544,804 V99A probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Olfr53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Olfr53 APN 7 140652476 missense probably benign 0.00
IGL01071:Olfr53 APN 7 140652914 missense possibly damaging 0.76
IGL02590:Olfr53 APN 7 140652392 unclassified probably null
IGL02694:Olfr53 APN 7 140652180 missense probably damaging 0.99
R0071:Olfr53 UTSW 7 140652257 missense probably benign 0.00
R0071:Olfr53 UTSW 7 140652257 missense probably benign 0.00
R0089:Olfr53 UTSW 7 140652311 missense probably damaging 0.99
R0586:Olfr53 UTSW 7 140652063 missense probably benign 0.35
R1209:Olfr53 UTSW 7 140652014 missense probably benign 0.03
R1491:Olfr53 UTSW 7 140652737 missense probably damaging 1.00
R1781:Olfr53 UTSW 7 140652506 missense probably damaging 0.99
R4060:Olfr53 UTSW 7 140652120 missense probably damaging 1.00
R4231:Olfr53 UTSW 7 140652740 missense probably damaging 1.00
R4299:Olfr53 UTSW 7 140652243 missense probably benign 0.00
R4398:Olfr53 UTSW 7 140652828 missense possibly damaging 0.65
R4675:Olfr53 UTSW 7 140652161 missense probably damaging 1.00
R4937:Olfr53 UTSW 7 140652621 missense probably benign 0.00
R5854:Olfr53 UTSW 7 140652578 missense probably benign 0.03
R6124:Olfr53 UTSW 7 140652594 missense probably damaging 1.00
R7092:Olfr53 UTSW 7 140652237 missense probably benign 0.16
R7167:Olfr53 UTSW 7 140652553 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTCATTCTGTGGACCCAAG -3'
(R):5'- GAAAGAGGCCAACATCCTGC -3'

Sequencing Primer
(F):5'- TGTGAGATACCCCCACTCC -3'
(R):5'- CCCAAGGCAAGCTTGACATC -3'
Posted On2015-06-12