Incidental Mutation 'R4236:Arhgef18'
ID321124
Institutional Source Beutler Lab
Gene Symbol Arhgef18
Ensembl Gene ENSMUSG00000004568
Gene Namerho/rac guanine nucleotide exchange factor (GEF) 18
SynonymsD030053O22Rik
MMRRC Submission 041053-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4236 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3393006-3456601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3450317 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 541 (I541T)
Ref Sequence ENSEMBL: ENSMUSP00000004684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004684
AA Change: I541T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000004684
Gene: ENSMUSG00000004568
AA Change: I541T

DomainStartEndE-ValueType
RhoGEF 105 297 2.62e-58 SMART
PH 340 443 5.57e-12 SMART
low complexity region 446 456 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
coiled coil region 697 800 N/A INTRINSIC
low complexity region 887 897 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 963 985 N/A INTRINSIC
low complexity region 991 1010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156085
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases are GTP binding proteins that regulate a wide spectrum of cellular functions. These cellular processes include cytoskeletal rearrangements, gene transcription, cell growth and motility. Activation of Rho GTPases is under the direct control of guanine nucleotide exchange factors (GEFs). The protein encoded by this gene is a guanine nucleotide exchange factor and belongs to the Rho GTPase GFE family. Family members share a common feature, a Dbl (DH) homology domain followed by a pleckstrin (PH) homology domain. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit greatly reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abca13 A T 11: 9,256,205 K168N probably damaging Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cela1 T C 15: 100,682,913 Y91C probably damaging Het
Chrnb3 C A 8: 27,393,993 L253M probably damaging Het
Col24a1 G T 3: 145,524,282 G1493* probably null Het
Dnah7a C T 1: 53,447,365 E3346K probably benign Het
Dock5 A T 14: 67,756,492 S1845T probably benign Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
F2rl1 A G 13: 95,513,288 L362P probably damaging Het
Gal3st2c T C 1: 94,008,741 F136S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm8300 A T 12: 87,517,165 D90V probably damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Klhl23 T C 2: 69,824,172 F129L probably damaging Het
Krt71 T C 15: 101,734,694 T460A probably benign Het
Madd C T 2: 91,167,028 R746Q probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh6 T G 14: 54,960,362 M440L probably benign Het
Myh7 T A 14: 54,991,118 S205C probably benign Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Pde3b A G 7: 114,521,688 T683A possibly damaging Het
Plcb2 A T 2: 118,709,566 L1082Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc6a6 T C 6: 91,741,276 V357A probably damaging Het
Slitrk6 T C 14: 110,750,148 E709G probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tfcp2l1 G A 1: 118,662,065 R285H probably benign Het
Tmem132d A G 5: 128,432,325 S14P possibly damaging Het
Tulp2 A G 7: 45,521,874 K360E probably damaging Het
Vmn1r60 A G 7: 5,544,804 V99A probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Arhgef18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Arhgef18 APN 8 3429553 missense probably damaging 1.00
IGL01649:Arhgef18 APN 8 3441211 splice site probably benign
IGL01736:Arhgef18 APN 8 3451624 splice site probably benign
IGL02206:Arhgef18 APN 8 3445034 missense probably benign 0.00
IGL02401:Arhgef18 APN 8 3437078 missense probably damaging 1.00
IGL02938:Arhgef18 APN 8 3450802 missense probably benign 0.02
IGL02943:Arhgef18 APN 8 3448553 missense probably damaging 0.99
IGL02990:Arhgef18 APN 8 3444904 missense probably benign 0.02
IGL03162:Arhgef18 APN 8 3441301 splice site probably null
R1622:Arhgef18 UTSW 8 3441272 missense possibly damaging 0.46
R1681:Arhgef18 UTSW 8 3439645 missense probably damaging 1.00
R1726:Arhgef18 UTSW 8 3454228 missense possibly damaging 0.46
R2126:Arhgef18 UTSW 8 3451939 missense probably damaging 0.99
R2161:Arhgef18 UTSW 8 3439575 nonsense probably null
R2878:Arhgef18 UTSW 8 3432759 missense probably benign
R3916:Arhgef18 UTSW 8 3454197 missense probably benign
R4231:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4233:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4234:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4235:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4450:Arhgef18 UTSW 8 3437097 missense probably damaging 0.97
R4539:Arhgef18 UTSW 8 3447070 missense probably benign
R4670:Arhgef18 UTSW 8 3434897 missense probably damaging 1.00
R4753:Arhgef18 UTSW 8 3444938 missense probably damaging 1.00
R4897:Arhgef18 UTSW 8 3444979 missense probably benign
R5313:Arhgef18 UTSW 8 3451629 critical splice acceptor site probably null
R5698:Arhgef18 UTSW 8 3439499 missense probably damaging 0.99
R5781:Arhgef18 UTSW 8 3439439 intron probably null
R5851:Arhgef18 UTSW 8 3434980 missense probably damaging 1.00
R5897:Arhgef18 UTSW 8 3439682 missense probably damaging 1.00
R5908:Arhgef18 UTSW 8 3453165 missense probably damaging 1.00
R6123:Arhgef18 UTSW 8 3437091 missense probably damaging 0.99
R6136:Arhgef18 UTSW 8 3454507 missense probably benign
R6240:Arhgef18 UTSW 8 3439658 missense probably damaging 1.00
R6617:Arhgef18 UTSW 8 3439592 missense probably damaging 1.00
X0021:Arhgef18 UTSW 8 3434942 missense probably damaging 1.00
Z1088:Arhgef18 UTSW 8 3439628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTGCCTGATTGCCTTG -3'
(R):5'- TAACACTGGATCTGCTGCGC -3'

Sequencing Primer
(F):5'- CTCTCCCTTAGATGCTGAGGATG -3'
(R):5'- GATCTGCTGCGCATGGG -3'
Posted On2015-06-12