Incidental Mutation 'R4236:Spc24'
ID321127
Institutional Source Beutler Lab
Gene Symbol Spc24
Ensembl Gene ENSMUSG00000074476
Gene NameSPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Synonyms2410030K01Rik, Spbc24
MMRRC Submission 041053-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R4236 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21755442-21760303 bp(-) (GRCm38)
Type of Mutationunclassified (937 bp from exon)
DNA Base Change (assembly) T to C at 21756202 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098942] [ENSMUST00000214149] [ENSMUST00000216057] [ENSMUST00000217382]
Predicted Effect probably benign
Transcript: ENSMUST00000098942
AA Change: D194G

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000096541
Gene: ENSMUSG00000074476
AA Change: D194G

DomainStartEndE-ValueType
Pfam:Spc24 75 192 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213665
Predicted Effect probably null
Transcript: ENSMUST00000214149
Predicted Effect probably benign
Transcript: ENSMUST00000216057
Predicted Effect probably benign
Transcript: ENSMUST00000217382
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abca13 A T 11: 9,256,205 K168N probably damaging Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cela1 T C 15: 100,682,913 Y91C probably damaging Het
Chrnb3 C A 8: 27,393,993 L253M probably damaging Het
Col24a1 G T 3: 145,524,282 G1493* probably null Het
Dnah7a C T 1: 53,447,365 E3346K probably benign Het
Dock5 A T 14: 67,756,492 S1845T probably benign Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
F2rl1 A G 13: 95,513,288 L362P probably damaging Het
Gal3st2c T C 1: 94,008,741 F136S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm8300 A T 12: 87,517,165 D90V probably damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Klhl23 T C 2: 69,824,172 F129L probably damaging Het
Krt71 T C 15: 101,734,694 T460A probably benign Het
Madd C T 2: 91,167,028 R746Q probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh6 T G 14: 54,960,362 M440L probably benign Het
Myh7 T A 14: 54,991,118 S205C probably benign Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Pde3b A G 7: 114,521,688 T683A possibly damaging Het
Plcb2 A T 2: 118,709,566 L1082Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc6a6 T C 6: 91,741,276 V357A probably damaging Het
Slitrk6 T C 14: 110,750,148 E709G probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tfcp2l1 G A 1: 118,662,065 R285H probably benign Het
Tmem132d A G 5: 128,432,325 S14P possibly damaging Het
Tulp2 A G 7: 45,521,874 K360E probably damaging Het
Vmn1r60 A G 7: 5,544,804 V99A probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Spc24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0331:Spc24 UTSW 9 21757313 missense possibly damaging 0.74
R3026:Spc24 UTSW 9 21756215 makesense probably null
R3027:Spc24 UTSW 9 21756215 makesense probably null
R3028:Spc24 UTSW 9 21756215 makesense probably null
R4231:Spc24 UTSW 9 21756202 unclassified probably null
R4233:Spc24 UTSW 9 21756202 unclassified probably null
R5635:Spc24 UTSW 9 21757390 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCTAACCTCTCCTGGAATACAC -3'
(R):5'- CTCACCGAGCCTAATGACTGG -3'

Sequencing Primer
(F):5'- TCTCCTGGAATACACAGCTAACAG -3'
(R):5'- TGGAATTCAATCCCTGGGAC -3'
Posted On2015-06-12