Incidental Mutation 'R4236:Zfp599'
ID321128
Institutional Source Beutler Lab
Gene Symbol Zfp599
Ensembl Gene ENSMUSG00000062794
Gene Namezinc finger protein 599
Synonyms
MMRRC Submission 041053-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R4236 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location22247430-22259895 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 22249745 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 375 (K375*)
Ref Sequence ENSEMBL: ENSMUSP00000083462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086281]
Predicted Effect probably null
Transcript: ENSMUST00000086281
AA Change: K375*
SMART Domains Protein: ENSMUSP00000083462
Gene: ENSMUSG00000062794
AA Change: K375*

DomainStartEndE-ValueType
KRAB 4 64 5.35e-33 SMART
ZnF_C2H2 228 250 5.59e-4 SMART
ZnF_C2H2 256 278 2.43e-4 SMART
ZnF_C2H2 284 306 1.69e-3 SMART
ZnF_C2H2 312 334 8.94e-3 SMART
ZnF_C2H2 340 362 8.47e-4 SMART
ZnF_C2H2 368 390 5.06e-2 SMART
ZnF_C2H2 396 418 7.9e-4 SMART
ZnF_C2H2 424 446 7.67e-2 SMART
ZnF_C2H2 452 474 1.64e-1 SMART
ZnF_C2H2 480 503 7.37e-4 SMART
Meta Mutation Damage Score 0.64 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abca13 A T 11: 9,256,205 K168N probably damaging Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cela1 T C 15: 100,682,913 Y91C probably damaging Het
Chrnb3 C A 8: 27,393,993 L253M probably damaging Het
Col24a1 G T 3: 145,524,282 G1493* probably null Het
Dnah7a C T 1: 53,447,365 E3346K probably benign Het
Dock5 A T 14: 67,756,492 S1845T probably benign Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
F2rl1 A G 13: 95,513,288 L362P probably damaging Het
Gal3st2c T C 1: 94,008,741 F136S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm8300 A T 12: 87,517,165 D90V probably damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Klhl23 T C 2: 69,824,172 F129L probably damaging Het
Krt71 T C 15: 101,734,694 T460A probably benign Het
Madd C T 2: 91,167,028 R746Q probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh6 T G 14: 54,960,362 M440L probably benign Het
Myh7 T A 14: 54,991,118 S205C probably benign Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Pde3b A G 7: 114,521,688 T683A possibly damaging Het
Plcb2 A T 2: 118,709,566 L1082Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc6a6 T C 6: 91,741,276 V357A probably damaging Het
Slitrk6 T C 14: 110,750,148 E709G probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tfcp2l1 G A 1: 118,662,065 R285H probably benign Het
Tmem132d A G 5: 128,432,325 S14P possibly damaging Het
Tulp2 A G 7: 45,521,874 K360E probably damaging Het
Vmn1r60 A G 7: 5,544,804 V99A probably benign Het
Other mutations in Zfp599
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Zfp599 APN 9 22249472 missense possibly damaging 0.94
IGL00845:Zfp599 APN 9 22251518 splice site probably benign
R0136:Zfp599 UTSW 9 22249742 missense probably benign 0.13
R0239:Zfp599 UTSW 9 22249759 missense probably damaging 1.00
R0239:Zfp599 UTSW 9 22249759 missense probably damaging 1.00
R0421:Zfp599 UTSW 9 22250547 splice site probably benign
R1699:Zfp599 UTSW 9 22250404 missense probably benign 0.20
R1723:Zfp599 UTSW 9 22258065 missense probably damaging 1.00
R1899:Zfp599 UTSW 9 22251549 missense probably benign 0.00
R4231:Zfp599 UTSW 9 22249745 nonsense probably null
R4233:Zfp599 UTSW 9 22249745 nonsense probably null
R4931:Zfp599 UTSW 9 22258123 missense probably damaging 0.98
R5117:Zfp599 UTSW 9 22250100 nonsense probably null
R5615:Zfp599 UTSW 9 22253869 missense probably benign
R5759:Zfp599 UTSW 9 22249661 missense probably damaging 1.00
R5915:Zfp599 UTSW 9 22249834 missense probably damaging 1.00
R6184:Zfp599 UTSW 9 22249651 missense probably benign 0.18
R6188:Zfp599 UTSW 9 22249990 missense probably damaging 1.00
R6657:Zfp599 UTSW 9 22250242 missense probably damaging 1.00
R6736:Zfp599 UTSW 9 22249844 missense probably damaging 1.00
R6752:Zfp599 UTSW 9 22249544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTGATGTCGAATGAGGTGTGAC -3'
(R):5'- TTCTGCTCTCAGGGAAAACTTACTC -3'

Sequencing Primer
(F):5'- GGGAGAAAGCTTTCCCACAGTC -3'
(R):5'- CTGAATGTGGGAAAGCTTTCTACC -3'
Posted On2015-06-12