Incidental Mutation 'R4236:Nxpe4'
ID321129
Institutional Source Beutler Lab
Gene Symbol Nxpe4
Ensembl Gene ENSMUSG00000044229
Gene Nameneurexophilin and PC-esterase domain family, member 4
Synonyms
MMRRC Submission 041053-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4236 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location48162023-48400025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48398837 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 467 (T467S)
Ref Sequence ENSEMBL: ENSMUSP00000149741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093853] [ENSMUST00000215780] [ENSMUST00000216998]
Predicted Effect probably damaging
Transcript: ENSMUST00000093853
AA Change: T467S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091375
Gene: ENSMUSG00000044229
AA Change: T467S

DomainStartEndE-ValueType
transmembrane domain 9 26 N/A INTRINSIC
Pfam:Neurexophilin 74 272 8.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215780
AA Change: T467S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217002
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abca13 A T 11: 9,256,205 K168N probably damaging Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cela1 T C 15: 100,682,913 Y91C probably damaging Het
Chrnb3 C A 8: 27,393,993 L253M probably damaging Het
Col24a1 G T 3: 145,524,282 G1493* probably null Het
Dnah7a C T 1: 53,447,365 E3346K probably benign Het
Dock5 A T 14: 67,756,492 S1845T probably benign Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
F2rl1 A G 13: 95,513,288 L362P probably damaging Het
Gal3st2c T C 1: 94,008,741 F136S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm8300 A T 12: 87,517,165 D90V probably damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Klhl23 T C 2: 69,824,172 F129L probably damaging Het
Krt71 T C 15: 101,734,694 T460A probably benign Het
Madd C T 2: 91,167,028 R746Q probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh6 T G 14: 54,960,362 M440L probably benign Het
Myh7 T A 14: 54,991,118 S205C probably benign Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Pde3b A G 7: 114,521,688 T683A possibly damaging Het
Plcb2 A T 2: 118,709,566 L1082Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc6a6 T C 6: 91,741,276 V357A probably damaging Het
Slitrk6 T C 14: 110,750,148 E709G probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tfcp2l1 G A 1: 118,662,065 R285H probably benign Het
Tmem132d A G 5: 128,432,325 S14P possibly damaging Het
Tulp2 A G 7: 45,521,874 K360E probably damaging Het
Vmn1r60 A G 7: 5,544,804 V99A probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Nxpe4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Nxpe4 APN 9 48394140 missense possibly damaging 0.63
IGL01723:Nxpe4 APN 9 48398598 missense probably benign 0.00
IGL03008:Nxpe4 APN 9 48393438 missense probably benign 0.01
IGL03022:Nxpe4 APN 9 48393248 missense probably damaging 0.99
IGL03271:Nxpe4 APN 9 48393045 missense probably damaging 0.99
R0633:Nxpe4 UTSW 9 48396597 missense probably benign
R1033:Nxpe4 UTSW 9 48393233 missense probably damaging 1.00
R1186:Nxpe4 UTSW 9 48393392 missense probably benign 0.23
R1296:Nxpe4 UTSW 9 48396493 missense probably benign 0.00
R1596:Nxpe4 UTSW 9 48396555 missense probably damaging 0.97
R1813:Nxpe4 UTSW 9 48393378 missense possibly damaging 0.87
R2511:Nxpe4 UTSW 9 48393233 missense probably damaging 1.00
R2902:Nxpe4 UTSW 9 48394146 missense probably benign 0.00
R4229:Nxpe4 UTSW 9 48392822 missense possibly damaging 0.80
R4230:Nxpe4 UTSW 9 48392822 missense possibly damaging 0.80
R4231:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4233:Nxpe4 UTSW 9 48398837 missense probably damaging 1.00
R4296:Nxpe4 UTSW 9 48398984 missense probably damaging 0.98
R5016:Nxpe4 UTSW 9 48392885 missense probably benign 0.12
R5644:Nxpe4 UTSW 9 48392750 missense probably benign 0.00
R5797:Nxpe4 UTSW 9 48396538 missense possibly damaging 0.86
R5979:Nxpe4 UTSW 9 48396562 missense probably benign 0.02
R6170:Nxpe4 UTSW 9 48392804 missense probably benign 0.12
R6208:Nxpe4 UTSW 9 48393378 missense probably benign 0.12
R6431:Nxpe4 UTSW 9 48392845 missense probably damaging 0.99
X0062:Nxpe4 UTSW 9 48399025 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAAATCAGCATCCAGTGGC -3'
(R):5'- TCTAACTACATCCTCTGGTGGG -3'

Sequencing Primer
(F):5'- TCCAGTGGCAAAAACATGGTTAC -3'
(R):5'- GTGGACATTGTTTATGCCATATGC -3'
Posted On2015-06-12