Incidental Mutation 'R4236:Mrps30'
ID321140
Institutional Source Beutler Lab
Gene Symbol Mrps30
Ensembl Gene ENSMUSG00000021731
Gene Namemitochondrial ribosomal protein S30
Synonyms2610020A16Rik, Pdcd9
MMRRC Submission 041053-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R4236 (G1)
Quality Score135
Status Validated
Chromosome13
Chromosomal Location118378381-118387252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118386840 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 132 (D132G)
Ref Sequence ENSEMBL: ENSMUSP00000022245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022245] [ENSMUST00000181168]
Predicted Effect probably damaging
Transcript: ENSMUST00000022245
AA Change: D132G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022245
Gene: ENSMUSG00000021731
AA Change: D132G

DomainStartEndE-ValueType
Pfam:PDCD9 1 423 1.7e-180 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000181168
AA Change: S13P
SMART Domains Protein: ENSMUSP00000137680
Gene: ENSMUSG00000097411
AA Change: S13P

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
low complexity region 117 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225170
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that is similar to the chicken pro-apoptotic protein p52. Transcript variants using alternative promoters or polyA sites have been mentioned in the literature but the complete description of these sequences is not available. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abca13 A T 11: 9,256,205 K168N probably damaging Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cela1 T C 15: 100,682,913 Y91C probably damaging Het
Chrnb3 C A 8: 27,393,993 L253M probably damaging Het
Col24a1 G T 3: 145,524,282 G1493* probably null Het
Dnah7a C T 1: 53,447,365 E3346K probably benign Het
Dock5 A T 14: 67,756,492 S1845T probably benign Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
F2rl1 A G 13: 95,513,288 L362P probably damaging Het
Gal3st2c T C 1: 94,008,741 F136S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm8300 A T 12: 87,517,165 D90V probably damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Klhl23 T C 2: 69,824,172 F129L probably damaging Het
Krt71 T C 15: 101,734,694 T460A probably benign Het
Madd C T 2: 91,167,028 R746Q probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Myh6 T G 14: 54,960,362 M440L probably benign Het
Myh7 T A 14: 54,991,118 S205C probably benign Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Pde3b A G 7: 114,521,688 T683A possibly damaging Het
Plcb2 A T 2: 118,709,566 L1082Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc6a6 T C 6: 91,741,276 V357A probably damaging Het
Slitrk6 T C 14: 110,750,148 E709G probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tfcp2l1 G A 1: 118,662,065 R285H probably benign Het
Tmem132d A G 5: 128,432,325 S14P possibly damaging Het
Tulp2 A G 7: 45,521,874 K360E probably damaging Het
Vmn1r60 A G 7: 5,544,804 V99A probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Mrps30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Mrps30 APN 13 118380610 missense probably damaging 1.00
R0030:Mrps30 UTSW 13 118382995 missense possibly damaging 0.94
R2439:Mrps30 UTSW 13 118385272 missense probably damaging 1.00
R2764:Mrps30 UTSW 13 118384588 missense probably benign 0.03
R4030:Mrps30 UTSW 13 118380541 missense probably damaging 1.00
R4231:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4232:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4234:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4235:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4625:Mrps30 UTSW 13 118386714 missense probably benign 0.14
R4935:Mrps30 UTSW 13 118386895 missense possibly damaging 0.82
R5363:Mrps30 UTSW 13 118387162 missense probably benign 0.39
R5986:Mrps30 UTSW 13 118384565 critical splice donor site probably null
R6566:Mrps30 UTSW 13 118387126 missense probably benign 0.00
R6681:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6694:Mrps30 UTSW 13 118386961 missense possibly damaging 0.82
R6699:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6700:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6788:Mrps30 UTSW 13 118380372 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AACCTGCAGGAAAGCTTGG -3'
(R):5'- ATTGTCCCAGAATGCCGCTG -3'

Sequencing Primer
(F):5'- TGGGAGTTCCAAGCTCACC -3'
(R):5'- TCCCAGAATGCCGCTGCTAAG -3'
Posted On2015-06-12