Incidental Mutation 'R4236:Cela1'
ID321148
Institutional Source Beutler Lab
Gene Symbol Cela1
Ensembl Gene ENSMUSG00000023031
Gene Namechymotrypsin-like elastase family, member 1
Synonyms1810062B19Rik, Ela1, Ela-1, 1810009A17Rik, PC-TsF
MMRRC Submission 041053-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R4236 (G1)
Quality Score206
Status Not validated
Chromosome15
Chromosomal Location100674421-100687921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100682913 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 91 (Y91C)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023775] [ENSMUST00000229869] [ENSMUST00000230572] [ENSMUST00000230740] [ENSMUST00000230744]
Predicted Effect probably damaging
Transcript: ENSMUST00000023775
AA Change: Y154C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023775
Gene: ENSMUSG00000023031
AA Change: Y154C

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 26 259 1.24e-88 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229235
Predicted Effect probably benign
Transcript: ENSMUST00000229869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229888
Predicted Effect probably damaging
Transcript: ENSMUST00000230312
AA Change: Y91C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230642
Predicted Effect probably benign
Transcript: ENSMUST00000230740
Predicted Effect probably benign
Transcript: ENSMUST00000230744
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, pancreatic elastase 1 is not expressed in the pancreas. To date, elastase 1 expression has only been detected in skin keratinocytes. Clinical literature that describes human elastase 1 activity in the pancreas or fecal material is actually referring to chymotrypsin-like elastase family, member 3B. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abca13 A T 11: 9,256,205 K168N probably damaging Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Chrnb3 C A 8: 27,393,993 L253M probably damaging Het
Col24a1 G T 3: 145,524,282 G1493* probably null Het
Dnah7a C T 1: 53,447,365 E3346K probably benign Het
Dock5 A T 14: 67,756,492 S1845T probably benign Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
F2rl1 A G 13: 95,513,288 L362P probably damaging Het
Gal3st2c T C 1: 94,008,741 F136S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm8300 A T 12: 87,517,165 D90V probably damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Klhl23 T C 2: 69,824,172 F129L probably damaging Het
Krt71 T C 15: 101,734,694 T460A probably benign Het
Madd C T 2: 91,167,028 R746Q probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh6 T G 14: 54,960,362 M440L probably benign Het
Myh7 T A 14: 54,991,118 S205C probably benign Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Pde3b A G 7: 114,521,688 T683A possibly damaging Het
Plcb2 A T 2: 118,709,566 L1082Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc6a6 T C 6: 91,741,276 V357A probably damaging Het
Slitrk6 T C 14: 110,750,148 E709G probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tfcp2l1 G A 1: 118,662,065 R285H probably benign Het
Tmem132d A G 5: 128,432,325 S14P possibly damaging Het
Tulp2 A G 7: 45,521,874 K360E probably damaging Het
Vmn1r60 A G 7: 5,544,804 V99A probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Cela1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1845:Cela1 UTSW 15 100685167 missense probably benign 0.43
R2060:Cela1 UTSW 15 100675322 critical splice donor site probably null
R2358:Cela1 UTSW 15 100681228 missense probably benign
R3968:Cela1 UTSW 15 100684653 missense probably damaging 1.00
R5491:Cela1 UTSW 15 100682980 missense probably damaging 1.00
R6140:Cela1 UTSW 15 100681156 missense probably benign 0.01
R6378:Cela1 UTSW 15 100687190 missense probably benign 0.00
R7057:Cela1 UTSW 15 100682893 missense possibly damaging 0.90
R7536:Cela1 UTSW 15 100675364 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCTTTGGTTCCCTAGGTCATAG -3'
(R):5'- GCACATCTAATGTCCAGCAGC -3'

Sequencing Primer
(F):5'- CTAGGTCATAGGTCTCAGGCTATAC -3'
(R):5'- CATCATATTGCCTAGAGCTGGAG -3'
Posted On2015-06-12