Incidental Mutation 'R4236:Krt71'
ID321149
Institutional Source Beutler Lab
Gene Symbol Krt71
Ensembl Gene ENSMUSG00000051879
Gene Namekeratin 71
SynonymsCu, mK6irs, Krt2-6g, mK6irs1, Ca, Cal4
MMRRC Submission 041053-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R4236 (G1)
Quality Score184
Status Validated
Chromosome15
Chromosomal Location101733949-101743109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101734694 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 460 (T460A)
Ref Sequence ENSEMBL: ENSMUSP00000023710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023710]
Predicted Effect probably benign
Transcript: ENSMUST00000023710
AA Change: T460A

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023710
Gene: ENSMUSG00000051879
AA Change: T460A

DomainStartEndE-ValueType
low complexity region 17 55 N/A INTRINSIC
Pfam:Keratin_2_head 59 127 1.6e-20 PFAM
Filament 130 443 1.19e-151 SMART
low complexity region 449 465 N/A INTRINSIC
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes a protein that is expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mutations in this gene result in waved hair and curly vibrissae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abca13 A T 11: 9,256,205 K168N probably damaging Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cela1 T C 15: 100,682,913 Y91C probably damaging Het
Chrnb3 C A 8: 27,393,993 L253M probably damaging Het
Col24a1 G T 3: 145,524,282 G1493* probably null Het
Dnah7a C T 1: 53,447,365 E3346K probably benign Het
Dock5 A T 14: 67,756,492 S1845T probably benign Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
F2rl1 A G 13: 95,513,288 L362P probably damaging Het
Gal3st2c T C 1: 94,008,741 F136S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm8300 A T 12: 87,517,165 D90V probably damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Klhl23 T C 2: 69,824,172 F129L probably damaging Het
Madd C T 2: 91,167,028 R746Q probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh6 T G 14: 54,960,362 M440L probably benign Het
Myh7 T A 14: 54,991,118 S205C probably benign Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr23 A G 11: 73,940,356 T37A possibly damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Pde3b A G 7: 114,521,688 T683A possibly damaging Het
Plcb2 A T 2: 118,709,566 L1082Q probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc6a6 T C 6: 91,741,276 V357A probably damaging Het
Slitrk6 T C 14: 110,750,148 E709G probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tfcp2l1 G A 1: 118,662,065 R285H probably benign Het
Tmem132d A G 5: 128,432,325 S14P possibly damaging Het
Tulp2 A G 7: 45,521,874 K360E probably damaging Het
Vmn1r60 A G 7: 5,544,804 V99A probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Krt71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Krt71 APN 15 101736674 missense probably damaging 1.00
IGL03076:Krt71 APN 15 101734597 missense probably benign 0.00
IGL03390:Krt71 APN 15 101734552 missense possibly damaging 0.93
R0040:Krt71 UTSW 15 101738433 missense possibly damaging 0.90
R0040:Krt71 UTSW 15 101738433 missense possibly damaging 0.90
R0041:Krt71 UTSW 15 101739318 missense probably damaging 1.00
R0153:Krt71 UTSW 15 101734706 missense possibly damaging 0.65
R0376:Krt71 UTSW 15 101738070 missense probably damaging 1.00
R0932:Krt71 UTSW 15 101736760 missense probably benign 0.20
R1263:Krt71 UTSW 15 101735466 missense probably damaging 1.00
R1646:Krt71 UTSW 15 101738764 splice site probably null
R1796:Krt71 UTSW 15 101742880 missense possibly damaging 0.68
R1954:Krt71 UTSW 15 101735466 nonsense probably null
R3001:Krt71 UTSW 15 101740471 splice site probably benign
R3793:Krt71 UTSW 15 101742910 missense probably damaging 1.00
R4751:Krt71 UTSW 15 101735466 missense probably damaging 1.00
R6445:Krt71 UTSW 15 101740340 missense probably benign 0.06
R7034:Krt71 UTSW 15 101738337 missense probably benign 0.41
R7036:Krt71 UTSW 15 101738337 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGGTCACAAGAAGCCCTCTC -3'
(R):5'- CAAGACTCAGCCATAGTGGG -3'

Sequencing Primer
(F):5'- ATCGGCCACCTTTCTTGGAGG -3'
(R):5'- CCATAGTGGGTATAAACTGAGTAAGC -3'
Posted On2015-06-12